Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Genomika I. ATG gén x transzkripciós fúzió (operon) transzlációs fúzió (fehérje) gfp transzkripció transzláció 5’ külön fehérje termékek kiméra (fúziós)

Hasonló előadás


Az előadások a következő témára: "Genomika I. ATG gén x transzkripciós fúzió (operon) transzlációs fúzió (fehérje) gfp transzkripció transzláció 5’ külön fehérje termékek kiméra (fúziós)"— Előadás másolata:

1 Genomika I. ATG gén x transzkripciós fúzió (operon) transzlációs fúzió (fehérje) gfp transzkripció transzláció 5’ külön fehérje termékek kiméra (fúziós) fehérje

2 Mi határoz meg egy gént? 1. Az öröklődés egysége, a fenotípusban jeleníti meg magát 2. Egy gén – egy enzim (Beadle és Tatum 1943) 3. Egy gén – egy polipeptid, vagy egy gén – egy expressziós termék (egy RNS vagy egy fehérje) 4. Biokémiai funkció önálló egysége (Jacob és Monod) 5. Egy genetikailag térképezhető lokusz 6. Az expresszió egysége - A gén egy DNS szekvencia, ami átíródik - és tartalmazza az átírást szabályozó szekvenciákat is 7. Egy kódoló szekvencia - a génnek az a része, ami fehérjévé transzlálódik -- egy rRNS, vagy tRNS lokusz egy gén -- az intronok részei a génnek?

3 ATG GGAGGA 2-8 nts (~ 5 nts) Shine-Delgarno Stop Riboszóma kötő hely (RBS) TTGACA ---17bp---TATAAT---A  70 -típusú promóter Szabályozó szekvenciák nts UUUUUUU Transzkripciós terminátor kódoló szekvencia A prokarióta gén egyszerű szerkezete változó

4 A start kodonok flexibilisek ATG GGAGGA Shine-Delgarno A start kodonok >90%-a ATG Más kodonokkal is kezdődhet a kódoló szekvencia. Nem túl gyakran GTG (Valin) és TTG (Leucin) Egy metionin ekkor is beépül, az első aminosav.

5 5’ - NNNNNAGGAGGU-N5-10-AUG kódoló szekvencia Shine-Delgarno szekvencia (RBS) start kodon UCCUCCA 3’ 30S alegység 16S rRNS A korrekt startkodon kijelölése (transzláció)

6 Operon szerkezet prokariótákban

7 Start 5’ ’ N RNAP Promóter mRNS transzkriptum Nincs sejtmag, ez teszi lehetővé Szimultán transzkripció és transzláció fehérje riboszóma

8 A gének operononokba szerveződnek TTGTGA - 30 nts - AAGAGGGCACCGATGGCG AB C A gén végeB gén kezdete CTCTTGGAGGACGCATGACG GGAGGACGCATGACG B gén vége C gén kezdete intergénes spacer Nem átfedő átfedő transzlációs csatolás (coupling) (riboszóma nem disszociál)

9 A génszerveződés hierarchiája Gén – a genetikai funkió egysége Operon – egy transzkriptumba átíródó gének Regulon – gének (operonok) azonos szabályozással Modulon – gének modulációja azonos stimulánsra Elemek – plazmid, kromoszóma, fág Genom ** növekvő komplexitás

10 Az első baktérium genom szekvencia (1995) The Institute for Genomic Research (TIGR) A Haemophilus influenzae Rd genomja Egy, gyűrűs kromoszóma 1,860,137 bp Külső kör – az adatbázisokban homológ kódoló szekvenciák A gének 40%-ának akkor még nem volt homológja

11 E. coli K12 Narancs téglalap -forward gének Sárga téglalap -gének a komplementer szálon Piros nyilak -rRNS Zöld nyilak -tRNA Fehér kör -REP szekvenciák Kék kör -hasonlóság bakteriofág fehérjékhez Napkorong -CAI (codon adaptation index)

12 Komparatív genomika Összetett genomok Gyűrűs és lineáris DNS elemek Nagymértékű változatosság

13 Mikrobiális genom szekvenciák

14 CGGTTGAAAGCGGTAGCGTCCATGCGTATTACTCTTGAGCGGTCGAACCTTCTGAAATCGCTGAACCACGTCCACCGGGT CGTCGAGCGTCGCAACACGATCCCGATCCTGTCCAACGTTCTGCTGCGCGCCTCCGGCGCCAATCTGGACATGAAGGCGA CCGACCTCGATCTGGAAATCACCGAAGCGACCCCGGCCATGGTGGAGCAGGCTGGCGCCACCACCGTACCGGCACACCTG CTTTACGAAATCGTGCGCAAGCTGCCGGATGGTTCCGAAGTGCTTCTGGCGACCAACCCGGACGGCTCCTCCATGACCGT TGCGTCCGGCCGCTCGAAATTCTCGCTGCAATGCCTGCCGGAAGCGGATTTCCCTGACCTCACCGCCGGCACCTTCAGCC ACACCTTCAAACTGAAGGCGGCCGATCTGAAGATGCTGATCGACCGGACGCAGTTTGCGATTTCGACCGAAGAGACGCGT TATTACCTGAACGGCATTTTCTTCCACACCATCGAAAGCAATGGCGAGCTGAAACTGCGCGCCGTCGCCACCGACGGTCA CCGCCTTGCGCGTGCTGACGTCGATGCGCCCTCCGGCTCCGAAGGCATGCCGGGCATCATCATTCCGCGCAAGACCGTCG GTGAACTGCAGAAGCTGATGGACAATCCGGAACTGGAAGTCACAGTCGAAGTCTCGGATGCGAAGATCCGCCTGGCCATC GGTTCCGTCGTTCTGACCTCGAAGCTGATCGACGGCACCTTTCCCGATTATCAGCGCGTCATCCCAACCGGCAACGACAA GGAAATGCGCGTCGATTGCCAGACCTTCGCCCGGGCAGTGGACCGTGTTTCGACGATTTCTTCCGAGCGCGGCCGCGCCG TGAAGCTGGCGCTAACTGACGGCCAGTTGACGCTGACCGTCAACAATCCCGACTCGGGAAGTGCTACCGAAGAAGTGGCC GTTGGCTACGACAATGATTCGATGGAAATCGGCTTCAATGCCAAATATCTCCTCGACATCACGTCGCAGCTCTCCGGCGA AGATGCGATTTTTCTGCTGGCGGATGCGGGTTCGCCAACACTGGTTCGCGATACCGCCGGCGACGACGCACTCTATGTTC TGATGCCGATGCGCGTTTAAAACCGACCGTTTTCTTCAATTTTTCCAGAAACGCCGGTGGATCGCTTCATCGGCGTTTTT TGATTCGGCGAACAGGTGGCTCTACCCGTAACTGAATTTTCTCAGTTACGACATTTTGCCTTGTTTTTGCGCCAAATGGG ATCAACAGTACGTAACAATTTTTTGACAATGACCAATACATCCGAGGGGAATCATGGCACTCAACCTGAAGCAACGGCTT GAACAAAAATTTGAGGAAGAAATCCGCTTTTTCAAAGGTATGGTCAGCCAGCCGAAAAAAGTCGGCGCCATTGTCCCGAC ATCGTCGATCACGGCGAAAAAGATGGCAAGCGTCATCAATCCCCATTCCGGCCTGCCGGTTCTGGAACTCGGTCCCGGCA CCGGCGTCATCACCAAGGCCATTCTGGCGCGCGGCATCAAGCCGGAGAGCCTGACGGCCATCGAATATTCGACTGATTTC TACAATCAGCTGCTCCGGAGCTATCCAGGCGTCAATTTCGTCAATGGTGACGCCTTCGATCTCGATGCGACGCTTGGCGA GCACAAGGGTCAGATGTTCGACAGCGTTATCTCCGCCGTGCCGATGCTGAATTTTCCGATGGCTGCCCGCATCAAGCTTC TCGATGAATTGCTGAAGCGCGTGCCGCACGGCCGACCCGTAGTACAGATATCCTACGGTCCGATTTCCCCGATCGTCGCG CAGCCGCATCTCTACCATATCCGCCATTTCGATTTCATCGTGCGCAATATTCCGCCGGCGCAATTGTGGACCTATACGCG GGCCTGATCGTCCCGCCAGAACAGACGAGGCCGTCATTTCCCAGTCGTGACGAATGGTTAGGGTGTTGATTACCCTCTCC ATTGCCTTTGAGGACCGATTGCCATGCATGCGCTCTACATCACCCACCCCCAGGTCAAGATCGACCCGGCTGTTCCCGTT CCCGAATGGGGGCTTTCGGAAAGGGGTGCTGAACGGGCGCGTGAGGCGAGCCGCCTTCCCTGGGCGAAAGCATTGCGGCG CATCGTTTCCAGCGCCGAAACCAAGGCAATCGAAACCGCCCATATGCTCGCGGAAACCTCCGGTGCAGCAATAGAGATCA TCGAAGCGATGCATGAAAACGACCGGTCCGCCACCGGTTTCCTGCCGCCGCCGGAATTCGAGAAGGCGGCGGACTGGTTC TTCGCCCATCCTGAGGAGAGTTTTCAAGGCTGGGAGCGGGCAATCGACGCGCAGGCGCGGATCGTCGAGGCCGTCAAAGC CGTTCTCGACCGACACGACGCACGGCAGCCGATCGCCTTTGTCGGCCATGGCGGCGTGGGCACACTGTTGAAATGCCATA TTGAAGGCCGCGGCATCAGCCGCAGCAAGGACCAGCCTGCTGGCGGTGGCAATCTTTTCCGCTTTTCCATCGCCGAATTT TCACTTGCAGCGGCCTCCCCCACATGCGACTGGACGGCAATGGAAACATGGCAGGGATAAGACAATGACCGCGCGCGAAA AACTCATCGTCGGGCTGGATGTTCCGACTGTGCAGCAGGCAGAAGACATCGTGTCGAAAATCGGCGACGAGGTCCTGTTC TACAAGATCGGTTATCAGCTGGTATTCGCCGGGGGTCTTGAATTCGCGCGTGACCTCGTCCAGAGCGGCAAGAAGGTCTT TCTCGACATGAAGCTGCTCGATATCGACAACACCGTCGCCTCGGGCGTCGAAAACATCGCCCGCATGGGCATGTCGATGC TGACGCTGCATGCCTATCCCAAAGCCATGCGTGCTGCCGTCAAGGCGGCGGAAGGCTCCGGCCTCTGCCTGCTGGGCGTC Mihez kezdhetünk ezzel? Hogyan találhatjuk meg a géneket?

15 Keresd a nyitott leolvasási kereteket (Open Reading Frame=ORF) GAAAAAGCTCCTGCCCAATCTGAAATGGTTAGCCTATCTTTCCACCGT Minden szekvenciának 3 lehetséges leolvasási kerete van (+1, +2, +3) A komplementerének is 3 lehetséges leolvasási kerete van (-1, -2, -3) 6 lehetséges leolvasási keret A triplett, a genetikai kód nem-megszakított természete segít 64 lehetséges kodon 61 igazi kodon 3 stop kodon (TGA, TAA, TAG) Véletlen eloszlás kb. a kodonok 1/21 része stop kodon E K A P A Q S E M V S L S F H R K K L L P N L K W L A Y L S T K S S C P I * N G * P I F P P

16 Minden szekvenciának meghatározzuk az összes lehetséges leolvasási keretét CACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTC CCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGG AGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACC AACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAA TGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCA ACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAA AACCGCCTCGCGGTGATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCAT TTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATT TCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGG CAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCG CGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAAC TGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTG CTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGA TGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACC ATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTG CCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCG TAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGA TCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCG ATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGG AGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGG CGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAAC GGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTT TGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAA CCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAG CCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCC GGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCA GCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACC ACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGAT GTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCG TAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCG TTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAAC CTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCG ATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGG EMBOSS programok: GETORF, PLOTORF

17 lacZ lacY Grafikus megjelenítés

18 Open Reading Frame (ORF) – átlagos méret A B. subtilis genomban, 98% a valószínűsége annak, hogy egy 500 nt hosszú ORF- en gén van

19 Az adatbázisok segíthetnek a gének azonosításában A szekvencia illesztő algoritmusok átvizsgálják az egész adatbázist, hogy van-e a mi génünkkel homológ. A leggyakrabban használt program a BLAST Basic Local Alignment Search Tool blastn – nucleotid nucleotidhoz BLAST blastp – fehérje fehérjéhez BLAST blastx – nukleotid szekvencia (6 frame-ben lefordítva) a fehérje adatbázishoz tblastn – fehérje szekvencia a nukleotid (6 frame-ben) adatbázishoz tblastx – nukleotid szekvencia (6 frame-ben) a nukleotid (6 frame-ben) adatbázishoz

20 A nyers DNS szekvencia analízisére a blastx nagyon hasznos A DNS szekvenciánkat a fehérje adatbázishoz hasonlítja (6 frame-ben) Az illeszkedés (homológia) némi támpontot ad a funkcióra Egy a gond – illeszkedés homológia alapján, ezért kísérletes bizonyíték kell!! Kijelölheti a kísérletes munka irányát!

21 A nukleotid megoszlás periodicitása a kódoló szekvenciákban 4076 szekvencia Bacillus subtilis-ból Purinban gazdag SD

22 Eltérések a kodon használatban Organizmusonként változó kedvenc kodon használat Organizmusonként és organizmuson belül is változó. Lehetséges válasz az aminoacil-tRNS ellátottságra A gének transzlációs gyakoriságára is hatással lehet DNAStar program

23 Az új generációs programok a nem-véletlen ismétlődő motívumok alapján jósolják meg a kódoló szekvenciákat (pl. Glimmer, GeneMark) – egész jók már

24 Áfedés a gének között gondot jelent Mekkora gondot? Átfedés a gének között ugyanazon a szálon. Gének közötti átfedés az ellentétes szálakon.

25 COGs – clusters of orthologous sequences, ortológok Információval kapcsolatos Sejt folyamatok Metabolizmus Ismeretlen funkció Nincs COG

26 Metabolizmus összehasonlítása Pirimidin bioszintézis Minden egyes betű egy-egy mikroorganizmust jelent Nagybetű jelzi az ortológot Kis betű azt, hogy nincs ortológ gp – a Mycoplasma-ból a teljes út hiányzik h – az útvonal eleje hiányzik – prekurzort a gazdától kapja?


Letölteni ppt "Genomika I. ATG gén x transzkripciós fúzió (operon) transzlációs fúzió (fehérje) gfp transzkripció transzláció 5’ külön fehérje termékek kiméra (fúziós)"

Hasonló előadás


Google Hirdetések