Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

BioGén tábor 2006 DNS szekvencia analízis, internetes adatbázisok a genetika szolgálatában Kósa János Semmelweis Egyetem ÁOK I.sz Belgyógyászati Klinika.

Hasonló előadás


Az előadások a következő témára: "BioGén tábor 2006 DNS szekvencia analízis, internetes adatbázisok a genetika szolgálatában Kósa János Semmelweis Egyetem ÁOK I.sz Belgyógyászati Klinika."— Előadás másolata:

1 BioGén tábor 2006 DNS szekvencia analízis, internetes adatbázisok a genetika szolgálatában Kósa János Semmelweis Egyetem ÁOK I.sz Belgyógyászati Klinika

2 BioGén tábor 2006 Nukleinsav adatbázisok Nucleotide Sequence Databases RNA sequence databases Protein sequence databases Structure Databases Genomics Databases (non-vertebrate) Metabolic and Signaling Pathways Human and other Vertebrate Genomes Human Genes and Diseases Microarray Data and other Gene Expression Databases Proteomics Resources Other Molecular Biology Databases Organelle databases Plant databases Immunological databases …

3 BioGén tábor 2006 Néhány ismertebb genom adatbázis NCBI EBI DDBJ Ensembl GeneCards KEGG HPRD TESS Transcription Element Search System

4 BioGén tábor 2006 Példa I: Adott gén szekvenciájának letöltése, értelmezése Feladat: a humán Bmp8a gén megtalálása, letöltése, e/i határok, leolvasási keret, fehérje szekvencia azonosítása, mRNS letoltese GenBank: Search: Gene/Bmp8a, > human NCBI ref seq: NM_ (mRNA) Elmentjük a kódoló részt, PCR primer tervezéshez

5 BioGén tábor 2006

6

7

8 Példa II: PCR primer tervezés Feladat: a humán Bmp8a gén konvencionális PCR-ben való monitorozásához PCR primereket terveznénk Primer3

9 BioGén tábor 2006

10

11 Példa III: Ismeretlen szekvencia azonosítása Feladat: egy beteg kutya lépéből univerzális 18S riboszómális RNS primereket használva egy ismeretlen kórokozó DNS szekvenciáját azonosítottuk (szekvenátorral) a kérdés az, hogy melyik fajról (fajokról) van szó Basic Local Alignment Search Tool Szekvencia:AGACCAGACCAAATGGTCAAACCGCTAACGCAAAAATACAACTACGAGCTTTTTAACTGCAACAAGTTTA ATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATTGCTACTCTGGTGAG GGT

12 BioGén tábor 2006

13

14

15

16

17

18

19


Letölteni ppt "BioGén tábor 2006 DNS szekvencia analízis, internetes adatbázisok a genetika szolgálatában Kósa János Semmelweis Egyetem ÁOK I.sz Belgyógyászati Klinika."

Hasonló előadás


Google Hirdetések