Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Molekuláris genetikai-genomikai módszerek Falus András.

Hasonló előadás

Az előadások a következő témára: "Molekuláris genetikai-genomikai módszerek Falus András."— Előadás másolata:

1 Molekuláris genetikai-genomikai módszerek Falus András

2 POLIMORFIZMUS Egy populáción belüli genetikailag meghatározott különbség

3 Genomvariációk Polimorfizmus Deléció Inszerció Kromoszóma Transzlokáció Variációk Gyakori szekvencia


5 Variációs típusok Nagyméretű: –Kromoszóma számbeli –Kromoszóma átrendeződések, kromoszómaszegment duplikációk, és deléciók Közepes: –Szekvencia ismétlődések (repeatek) –Transzpozonok –Kis deléciók, szekvenciális és tandem repeatek (mikroszatelliták) Kicsi: –Single Nucleotide Polymorphisms (SNP-k) –Egyetlen bázis érintő inszerciók és deléciók (indelek)


7 Mi az SNP (Single Nucleotide Polymorphism)? ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT   snp snp Az SNP-k replikációs hiba vagy DNS károsodás révén jönnek létre. Ugyanahhoz a fajhoz tartozó két egyed között egyetlen bázis eltérése ugyanabban a DNS pozícióban, gyakoriság >1 %.

8 Az SNP-k típusai Génben lévő, kódoló SNP-k –Nem-szinoním Fenntartja vagy megváltoztatja a fehérje szerkezetét/funkcióját –szinoním Fenntartja vagy megváltoztatja a splicing-ot Génben lévő, nem-kódoló SNP-k –Szabályozó/Regulációs SNP-k Fenntartja vagy megváltoztatja a génexpressziót –Intronban lévő SNP-k Fenntartja vagy megváltoztatja a génexpressziót/splicing-ot Kapcsolt SNP-k (túlnyomó számú) –Rendszerint gének közöttiek (intergenikusak)

9 Az SNP-k megváltoztathatják vagy változatlanul hagyhatják a fehérje szerkezetét Fehérje leucinról leucinra Nincs változás a fehérje szerkezetében RNS kodon CUC-ról CUG-re DNS SNP C-ről G-re Leucin mRNS

10 SNP térképek Sok ember genomjának szekvenálása A bázissorrendek összehasonlítása az SNP-k felderítése céljából Egy olyan humán genomtérkép elkészítése, ami az összes SNP-t tartalmazza = ez az SNP térkép Emberi genomban ~10.000.000 SNP (1/300)

11 SNP térképek Az összes szekvenált kromoszóma Az összes regisztrált SNP SNP pozíció

12 SNP Profil/Mintázat Minden egyes ember genomja egy sajátos SNP mintázatot hordoz. Az emberek SNP profiljuk/mintázatuk alapján csoportosíthatók. Az SNP profilok fontosak a gyógyszeres terápiában a válaszkészség meghatározásában. Kapcsolat lehet bizonyos SNP profilok és egy bizonyos kezelésre adott meghatározott válaszreakciók között.

13 Betegség iránt fogékony populáció Az összes egyed genotipizálása sok ezer SNP-re ATGATTATAG ATGTTTATAG Az összes rezisztens személynek A van az X gén 4-es pozíciójában, míg minden fogékonynak T van ugyanabban a pozícióban génX Rezisztens populáció

14 SNP Profilok

15 AZ SNP-k felhasználása Génazonosítás és –térképezés Diagnosztika/kockázat becslés A válaszreakció megbecslése Homogenitás vizsgálat/kísérlet tervezés A gén funkciójának azonosítása

16 Az SNP adatok felhasználása Evolúciós vizsgálatok Különböző polpulációk evolúciós történetének felderítésére „DNS ujjlenyomat”készítés Apasági vizsgálatok, bűnügyek Markerként használhatók poligénes jellegek térképezése során Genotípus specifikus gyógykezelés A legtöbb gén SNP-ket tartalmaz –A gének 93%-ának egynél több SNP-je van –39%-uk 10-nél több SNP-t tartalmaz!

17 Van-e összefüggés a marker megléte és a betegség között? Betegségre hajlamos Kontroll Betegségre nem fogékony Allél 1Allél 2 Az A marker összefüggést mutat a fenotípussal A Marker : Allél 1 = Allél 2 =


19 Következtetés korábbi adatokból és megfigyelésekből Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7 Patient 8 Patient 9 Patient 10 Patient 11 Patient 12 Good response No response Good response No response Good response No response ATGCTTCCCTTTTAAA ATTGTTCCCTTTTAAA ATTGTTGCCTTTTAAA ATGGTTGCCTTTTAAA ATAGTTGCCTTTTAAT ATGATTGCCTTTTAAA ATGATTGGCTTTTAAA ATGTTTCGCTTTTAAA ATGTTTTGCTTTTAAA ATTTTTTGCTTTTAAA ATCTTTTGCTTTTAAA SNP: single nucleotide polymorphism Good response 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

20 Következtetés előre; ki fog jól válaszolni a gyógyszerre? From McLeod and Evans, Ann Rev of Pharmacol and Toxicol, 2001: 41,101-121 GCCCACCTCGCCCGCCTC

21 A farmakogenomika nagy igérete "Pharmacogenomics will radically change the manner in which we develop drugs." "Soon, we will be able to get the right drug into the right patient." "Applying pharmacogenomics to drug development will cut cycle times to 1.5 - 2 years." "Pharmacogenomics will be able to bring removed drugs back on the market, by predicting who is susceptible to adverse events." Közel vagyunk???


23 TRINUKLEOTID (TRIPLET) REPEAT BETEGSÉGEK  A trinukeotid repeatek nagyon gyakori szekvenciák - a legtöbb nem kapcsolódik betegséggel - s ok közülük polimorf (változik a repeatek száma )  Két fő típusuk van - Nem-kódoló eltérő mechanizmusúak - Kódoló poliglutamin polialanin


25 Poliglutamin Polialanin betegségek Neurodegeneratív betegségek Különböző fehérjék Funkciónyerés Változó hosszúság Expanzió Replikációs csúszás CAG vagy CTG repeat Fejlődési rendellenességek Transzkripciós faktorok Funkcióvesztés +/- Konstans hossz Állandó Egyenlőtlen crossing over GCA, GCT, GCG, GCC repeatek - nem teljesek

26 a/ feltüntetett repeatszámok a normális tartományra jellemző értékek; b/ zárójelben az érintett fehérjék neve szerepel (huntingtin) = kódoló szakaszban= nem kódoló szakaszban (Huntingtin)


28 MATLEKLMKAFESLKSFQQQQQQQQQQQQQQQQQQQQQQQPPPP PPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPK KELSATKKDRVNHCLTICENIVAQSVRNSPEFQKLLGIAHELFLLCSDD... HUNTINGTIN 350 kD fehérje 10-11 kb transzkriptum mindenütt expresszálódik ismeretlen funkció összefüggés a repeat-szám és a betegség kezdete között Huntington’s Disease Collaborative Research Group 1993 nyomán

29 PCR


31 Q-PCR





36 Összehasonlító hibridizáció Két különböző biológiai forrás (pl. beteg/egészséges)

37 Microarray Overview Prepare Fluorescently Labeled Probes ControlTest Hybridize,Wash MeasureFluorescence in 2 channels red/green Analyze the data to identify patterns of gene expression

38 Diffúz nagysejtes B sejt lymphoma Szövettani Immunológiai PCR (egyes gének) módszerrel Eddig nem volt diff. diagnózisa:

39 A melanoma máj metastasis prediktor génkészlete Előre jelezni melyik melanomás betegnek lesz májáttétje??

40 Az egyes betegek mintáiból készült mikroarray-k Az adatok számítógépes csoportosítása Minták (X-tengely) Gének (10 2 -10 3 ) Diagnózis, megelőzés, terápia meghatározása Prediktor gének kiválasztása A betegségre nézve szelektív mikroarray fejlesztése A mikroarray orvosi gyakorlatban való felhasználásának elvi háttere



43 3’5’ PCR target SNP site Labeled terminating NTP Tag SNP primer 5’ 3’ 5’ SNP Primer Tag complement for Hybridization capture Substrate (spot on plate) Denature & Hybridize Primer Extention






Letölteni ppt "Molekuláris genetikai-genomikai módszerek Falus András."

Hasonló előadás

Google Hirdetések