Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

1 Mutációk. 2 Mutáció A mutáció az örökítő anyag (DNS) ugrásszerű megváltozása A mutáció öröklődik A mutációk a populációk genetikai változatosságának.

Hasonló előadás


Az előadások a következő témára: "1 Mutációk. 2 Mutáció A mutáció az örökítő anyag (DNS) ugrásszerű megváltozása A mutáció öröklődik A mutációk a populációk genetikai változatosságának."— Előadás másolata:

1 1 Mutációk

2 2 Mutáció A mutáció az örökítő anyag (DNS) ugrásszerű megváltozása A mutáció öröklődik A mutációk a populációk genetikai változatosságának (diverzitásának, polimorfizmusának) forrásai Hasonló folyamat a modifikáció: a fenotípus megváltozása környezeti hatásra. Ez nem öröklődik és nem érinti a DNS-t, csak fenotípusos polimorfizmust okoz, genetikait nem.

3 3 A mutációk örökölhetősége A mutáció mindig átadódik az utódsejtekre, de az utódokba (egyedekbe) csak az a mutáció öröklődik, amely az ivarsejteket (vagy az azokat képző sejteket) érinti.

4 4 Genetikai polimorfizmus Különböző formák egyidejű létezése egy fajon belül –Egyedek közti azonosság = 99.9% –~ különbség = 0.1%

5 5 Mutációk a polimorfizmus forrásai

6 6 A mutációk okai I. Spontán –Nemkívánatos kémiai reakciók –Hibák Replikáció Crossing over (Hibajavítás csökkenti)

7 7 A mutációk okai II. Indukált –Környezeti hatások (Mutagének) Fizikai: Sugárzások UV Ionizáló: rtg és radioaktív sugárzás Kémiai A máj a benzpirént reaktív epoxiddá alakítja..

8 8 A mutációk típusai (méret alapján) Nagy vagy kromoszóma mutációk (egy vagy több kromoszómát érint) –Genom mutáció vagy kromoszóma számváltozások –Kromoszóma szerkezeti változások Közepes v. kicsi (egy vagy néhány nukleotidot érint) Gén vagy pontmutáció

9 9 Kromoszóma mutációk azok a folyamatok, melyek kromoszóma részek átrendeződését, a kromoszómák számának megváltozását vagy akár az egész kromoszóma szerelvény számának változását eredményezik. E változások többnyire mikroszkóppal is láthatók. A kromoszóma mutációk

10 10 A kromoszóma szerkezeti változások típusai egy kromoszóma darab kiesése (deléció) Duplikáció: egy kromoszóma régió megkétszereződése. Inverzió: egy kromoszóma szakasz 180 fokos átfordulása az adott kromoszómán belül. gének sorrendjének megváltozása egy kromoszómán (transzpozíció) két nem homológ kromoszóma közötti részek (kölcsönös) áthelyeződése (transzlokáció)

11 11

12 12 Egy faj alap kromoszómaszáma a monoploid szám (n). Pl. ember esetében 23, búzánál 7. A szervezetek, melyek ezek egészszámú többszörösét hordozzák az euploidok. Azok az euploidok, melyek több mint kétszeresét hordozzák a kromoszómaszámnak a poliploidok. Pl.: a búza esetében 6n=42. A termesztett banán triploid – nincs magja, mert nincs normélis meiózisa. Normális meiózis feltétele: kromoszómapárok (páros ploidia) A haploid szám (n) a gamétákban jelenlevő kromoszómaszám. Diploid szervezetek ivarsejtjei monoploidok. Az aneuploidoknál néhány kromoszómával több, vagy kevesebb van a genomban. Változások a kromoszóma számban

13 13 A 21-es kromoszóma triszómiája: Down kór Az élő születések 0,15%-a, gyakorisága az anya korától függ. Szellemileg visszamaradott (IQ=20-50), széles, lapos arc, távolálló szemek, alacsony növés, nagy, redőzött nyelv. A nő lehet fertilis és fele-fele arányban adhat normális és triszómiás utódokat. A férfiak nem reproduktívak. Sokféle belső fejlődési rendellenesség

14 14 Az anya életkora és a Down kór gyakorisága

15 15 A termesztett hexaploid búza kialakulása

16 16 Gén (pont) mutációk

17 17 A helyettesítés helye alapján lehet Intergénikus Intragénikus Kódoló régió: –Nem szinonim –Aminosav csere vagy stop kód kialakulása –Szinonim (csendes) –Nincs aminosav csere Nem-kódoló régió (Intron) Nincs aminosav csere, tehát ez is csendes mutáció ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT  

18 18 A genetikai kodon szótár

19 19 Egy nukleotid beékelődése vagy kiesése - kereteltolódás

20 20 kialakulása: replikációs hiba Új szál kihurkolódása Templát szál kihurkolódása


Letölteni ppt "1 Mutációk. 2 Mutáció A mutáció az örökítő anyag (DNS) ugrásszerű megváltozása A mutáció öröklődik A mutációk a populációk genetikai változatosságának."

Hasonló előadás


Google Hirdetések