Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Kedvenc Természettudósom: Nikolaus Rajewsky… „a microRNS Pápa” Szabó Péter M., Informatikai Kar Eötvös Lóránt Tudományegyetem, Budpest.

Hasonló előadás


Az előadások a következő témára: "Kedvenc Természettudósom: Nikolaus Rajewsky… „a microRNS Pápa” Szabó Péter M., Informatikai Kar Eötvös Lóránt Tudományegyetem, Budpest."— Előadás másolata:

1 Kedvenc Természettudósom: Nikolaus Rajewsky… „a microRNS Pápa” Szabó Péter M., Informatikai Kar Eötvös Lóránt Tudományegyetem, Budpest

2 A bioinformatika születése A molekuláris biológia és az informatika határterülete Az új módszerekkel előállított hatalmas kísérletes adat feldolgozása csak informatikai módszerekkel képzelhető el. Az első kézzelfogható eredménye az emberi DNS szekvenálása a Human Genome Project (HGP) volt.

3 Human Genome Project

4 A DNS szerkezete Az emberi sejtekben a dezoxiribonukleinsav (DNS) molekula elkülönülve a sejt többi alkotórészétől a sejtmagban található. A DNS egy adathordozó molekula, amely:  két konstans vázszerkezetből  És az őket összekötő variábilis, kódoló molekulákból, nukleotidokból áll. A kód négyféle értéket vehet fel:  alanin (A)  timin (T)  citozin (C)  uracil (U).

5 A DNS szerkezete …a két DNS szál kódja pontosan a egymás „fordítottja” vagyis komplementere. A két DNS-szálat a nukleotidok csak abban az esetben kapcsolják össze, ha az ekvivalens pontokon az adenin timinnel, a guanin pedig a citozinnal kapcsolódhat össze. Ezért... G T CT G TT GGGG TT A C A CCTT GA A A C AA C CCC AA G CT G T GGAA C T

6 Gén Definíció szerint, fehérjét kódoló DNS szakasz. Egy egyén minden sejtje ugyanazt a DNS-t tartalmazza, mégis óriási különbségek mutatkoznak azonos gének működésében az egyes sejttípusok között A teljes emberi genom (DNS-kód) körülbelül gént tartalmaz, annak nagyjából 1 %-át teszik ki. A teljes génállomány működtetésére egyedül a petesejt és egyes őssejtek képesek…

7 Génexpresszió AA C A C C AAG CU G U G T CT G TT GGGG TT A C A CCTT GA A A gének expressziója során egy messenger (hírvivő) RNS (mRNS) készül a gént tartalmazó DNS-szakaszról. Az mRNS molekula a lemásolt DNS szakasz komplementer párja, néhány apró különbséggel, például benne a timint (T) uracil (U) helyetesíti. DNS RNS

8 22283 gén expressziója 26 egészséges emberi szövetben (forrás: Gene Expression Omnibus) alacsony expresszió nincs mérhető expresszió magas expresszió („magas”, „alacsony” vagy „azonos” a mediánhoz viszonyítva) azonos expresszió

9 Génexpresszió A sejtben jelenlévő egyetlen gént átírásával hatalmas mRNS kópiaszám jöhet létre, illetve az expresszió kikapcsolásával számuk minimálisra csökkenhet. A gének expressziójának fokát a róluk átíródó mRNS molekulák mennyisége határozza meg. A dekódolás a sejtmagon kívül történik, az mRNS-t fehérjék szállítják a riboszómákhoz, melyek a sejtek „fehérje gyárai”.

10 mRNS molekulák transzlációja (fordítása fehérjékké) Az mRNS molekulák leolvasása során az olvasási keret három egymást követő nukleotidot (kodont) feletet meg egy aminosavnak. Összesen 4 3 = 64 variáció képzelhető el. A fehérjéket húszféle aminosav építheti fel, így egyeseknek több kodon is megfeleltethető. Létezik továbbá 2 STOP kodon (UAA, UAG), illetve a sorban az első AUG kód a START.

11 mRNS molekulák transzlációja: A kodonok jelentései Nukleotidok rövidítései, és pozíciójuk Kodonok Aminosavak rövidítései

12 ACUAUGAUUCGCGGCAGCGCCCCGGCGGGAAAAUUAUAG START Met Ile Arg Gly UCG Ala GGG Pro Riboszóma mRNS mRNS molekulák transzlációja

13 …de ki az a Rajewsky? …de mi az a mikroRNS?

14


Letölteni ppt "Kedvenc Természettudósom: Nikolaus Rajewsky… „a microRNS Pápa” Szabó Péter M., Informatikai Kar Eötvös Lóránt Tudományegyetem, Budpest."

Hasonló előadás


Google Hirdetések