Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

A humán genom projekt 2. Mol. biol. módszerek Dr. Sasvári Mária.

Hasonló előadás


Az előadások a következő témára: "A humán genom projekt 2. Mol. biol. módszerek Dr. Sasvári Mária."— Előadás másolata:

1 A humán genom projekt 2. Mol. biol. módszerek Dr. Sasvári Mária

2 Kb. 40, ,000 fehérje kódoló gén (sokkal kevesebb, mint amennyit vártunk) vagyis a gének a genom kevesebb mint 5%-át foglalják el….. A “hasznos információ” - hány génünk van? A “hasznos információ” - hány génünk van? Hogyan találjuk meg a géneket?

3 Kiindulási pont: Az agy (és más szövetek) mRNS információtartalma (cDNS) Gén = az az információ, amely az egyes szövetekben kifejeződik (expresszálódik) Rövid másolatok ( bp) PCR reakcióval: Random primer Craig Venter

4 EST = expressed sequence tag Olyan rövid DNS szekvencia részletek, melyek kifejeződnek (az agyban ill. máshol) EST könyvtár Az agyban (ill. más szövetekben) kifejeződő gének azonosítására alkalmas

5 2. Hol van az EST a humán genomban? ‘in silico’ keresés BLAST – Basic Local Alignment Search Tool 1. EST -k szekvenálása 2375 agyi EST szekvenálása + BLAST 3. Gének azonosítása, új gének felfedezése < 400 ismert génKözel 2000 új gén felfedezése

6 A gének könyve Celera, 2001: kb EST  kb humán gén

7 Gének azonosítása ‘in silico’ Mi jellemző a génre: 1. Start jel (start kodon) 2. Stop jel (stop kodonok) NE LEGYENEK SŰRŰN! 3. Exon/intron átmenet: jellemző szekvenciák Kereső programok pl. ORF (NBCI)

8 ORF= open reading frame =„Olvasási keret” GTGCGTGAGC GTGGCCACCG AGCGCGCCCT GCAGACGCCC ACCAACTCCT TCATCGTGAG CCTGGCGGCC GCCGACCTCC TCCTCGCTCT CCTGGTGCTG CCGCTCTTCG TCTACTCCGA GGTGAGCCGC GTCCGGCCGC ACGAGCATCC TCACCTGCTC

9 NCBI ORF finder: „Olvasási keret kereső”

10 Transzkripciós faktorok 1 DNS kódoló régió 5’ nem kódoló régió promoter enhancer / silencer szekvenciák DNS-dep. RNS-pol. II. Transzkr. F. (FEHÉRJÉK) TATAGCGT TATA-box: TATA A ATAT ATAT GC-box: GGGGCGGGG GT/CACC-box: GGTGTGGG TATA GC GT Zn 2+ Y CC F L HH... Sp1

11 DNS-fehérje kölcsönhatás vizsgálat Gél retardáció Electrophoretic Mobility Shift Assay (EMSA) DNS-fehérje kölcsönhatás vizsgálat Gél retardáció Electrophoretic Mobility Shift Assay (EMSA)

12 EMSA Szabad DNS darab (jelölt oligo) * DNS- fehérje komplex * START Hagyományos elektroforézis

13 02468perc Kapilláris elektroforézis lassabb EMSA gyorsabb Szabad DNS darab (jelölt oligo) * DNS- fehérje komplex *

14 Specifikus-e a DNS-fehérje kötődés ? Kompetíciós (versengési) kísérletek – CCCTTGGTGGGGGCGGGGCCTAAGCTGCG –3’ 3’– GGGAACCACCCCCGCCCGGGATTCGACGC –5’ F 5’– „vad típusú próba” 5’– CCCTTGGTGGGGGCGGGGCCTAAGCTGCG –3’ 3’– GGGAACCACCCCCGCCCGGGATTCGACGC –5’ „specifikus kompetitor” „nem-specifikus (mutáns) kompetitor” 5’– CCCTTGGTGGGTTGGGGGCCTAAGCTGCG –3’ 3’– GGGAACCACCCAACCCCGGGATTCGACGC –5’ A jelölt oligo a „próba” A nem jelölt oligo a „kompetitor”

15 123 EMSA: A specifikus kötődés igazolása + Nem spec. komp.Spec. Komp. + nem látjuk 2 látjuk 3

16 123 EMSA: A specifikus kötődés igazolása: supershift Spec. ellenanyag + DNS- fehérje komplex * még lassabb „supershift” 2 + Spec. ellenanyag + antipeptid 3 +

17 Rekombiáns DNS technológia a gyógyszeriparban Humán rekombináns fehérjék előállítása gyógyászati célra Rekombiáns DNS technológia a gyógyszeriparban Humán rekombináns fehérjék előállítása gyógyászati célra

18 Rekombináns gyógyszerek tPAtrombózis VIII. faktor hemofilia CSF (colony stimulatong factor) immundeficiencia eritropoetin anemia hGF (growth factor) hGF hiány (növekedési rendellenesség) inzulin diabetes interleukin immunodeficiencia VACCINÁK Pl. hepatitis B FEHÉRJÉK ipari előállítása ?

19 H umán génexpresszió Prokariótákban Expressziós vektorok A humán gén “háziasítása” - csak exonok (cDNS) - bakteriális promoter - bakteriális riboszóma kötőhely Az idegen fehérje expressziójának ki/be kapcsolása ProK DNS lac promoter lac operátor Humán fehérje cDNS Represszor fehérje +IPTG indukció expresszió

20 Inzulin: Az első engedélyezett rekombináns gyógyszer 1. Vektor konstrukció Amp R ori lacZ (  gal) Inzulin A vagy B lánc (inszert) Mesterséges “ inzulin gén” Aminósav szekvencia  bázisszekvencia

21 2. Bakteriális transzformáció, AmpR klónok szelektásása és klónozása E. coli Bakteriális kromoszóma lac represszor Amp R plazmid 3. Fúziós fehérje termelése IPTG adásra 4. Lízis, fehérje izolálása, tisztítása 6. A és B lánc in vitro egyesítése  gal inzulin 5. CN Br kezelés: Metionin lebomlik, inzulin felszabadul

22 Met-hiányos hGH bakteriális expressziója 1. Transzformáció szelekció növesztés 2. hGH szekréció a periplazmás térbe 3. Bakteriális periplazmás proteáz: levágja a szignál szekvenciát 4. Met-nélküli rec hGH tisztítása 1. Vektor konstrukció hGH Bakteriális szignál szekvencia (extracelluláris) Amp R

23 Riporter rendszerek Riporter gének EuK sejt sejtmag Virus-vektor-riporter gén konstruktum Expresszió mérés a riporter fehérje alapján • luciferáz ATP  ADP + P i + fény •  -galaktozidázLaktóz analóg  kék színű termék KÉK SEJTEK • CAT (kloramfenikol acetil transzferáz)

24 Riporter gének felhasználása pl. Transzkripciós faktorok (TF) tesztelése riporter 1 2 A vektor B vektor 3 1: enhancer 2: promoter 3: TF génje EuK sejt sejtmag TF

25 megtermékenyített petesejt vákum csipesz Transzgenikus állatok 1982: az óriás egér Növekedési hormon gén injektálása a hím pronukleuszba

26 1. Mikroinjektálás (több száz petesejt, mikromanipulátor) 2. Beültetés ál-terhes nősténybe 3. Az utódok ellenőrzése (PCR a farokból) 4. Pároztatás 5. Beltenyésztés - Klónozás? A transzgenikus állatok elkészítése

27 A t-PA-t tejelő egér t-PA + lactalbumin szignál szekvencia szövet specifikus promoter szekréció a tejbe: 0.1 mg t-PA/ml tej Jövő: transzgenikus tehén? (JUH, KECSKE) Molecular Farming A transzgenikus állatok klónozása


Letölteni ppt "A humán genom projekt 2. Mol. biol. módszerek Dr. Sasvári Mária."

Hasonló előadás


Google Hirdetések