Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

A humán genom projekt Mol. biol. módszerek 1. Dr. Sasvári Mária.

Hasonló előadás


Az előadások a következő témára: "A humán genom projekt Mol. biol. módszerek 1. Dr. Sasvári Mária."— Előadás másolata:

1

2 A humán genom projekt Mol. biol. módszerek 1. Dr. Sasvári Mária

3 A HGP “munkapéldánya”

4 HGP (Human Genome Project) Francis Collins 20 központ, állami támogatás NCBI:National Center of Biotechnology Information CeleraGenomics (privát szektor) Craig Venter

5 2001 febr 16 Nature: HGP National Human Genome Research Institute NIH, USA) US Department of Energy Wellcome Trust (Anglia) Japán, Franciaország, Németország, Kina kb. 300 millió dollár (fele US támogatásból) 2001 febr 16 Science: Celera A humán genom első nyers szekvenciája

6 A HGP hierarchikus rendszere A HGP hierarchikus rendszere Nagy felbontás Alacsony felbontás Citogenetikai (kromoszómasáv) térképek Átfedő fragmentumok klónozása Restrikciós térképezés Szekvenálás

7 Minden kezdet nehéz J. Watson, a HGP első elnöke Első cél: minél több marker kifejlesztése (átlagos távolság: bp legyen) Marker: Egyszer előfordul ó (‘unique’) szekvencia ( bp) Eredmény: db marker

8 A hierarchikus rendszer felépítése bp darabok Izolált kromoszómák feldarabolása ritkán vágó restrikciós endonukleázokkal A keletkezett darabok klónozása  BAC (Bacterial Arteficial Chromosome) könyvtár létrehozása

9 A hierarchikus rendszer felépítése BAC könyvtár: átfedő darabok Következő lépések: 1. restrikciós térképezés 2. Sorba-rendezés 3. A minimális számú BAC klón kiszelektálása

10 A végek szekvenálása GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT BAC könyvtárból fág könyvtár kb bp (BAC) kb bp darabok (átfednek) A szekvenciák sorba rakása GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT

11 Összerakás

12 Craig Venter Celera: A “géppisztoly” módszer 2000 bp és bp darabok A végek szekvenálása, összerakás: AAGGACTTATG____________________GGACACAGGTTATGG GACTTA_____CGTTGGA GAGAGGACACA________________CGTTATATTG

13 1992-es adatok a DNS szekvenálásról: 1$/bp, 100,000 bp/év Humán genom 3x10 9 bp: 30,000 év, 3 miliárd dollár ? Módszertani áttörések •Automata DNS szekvenálás kifejlesztése •Polimeráz láncreakció (PCR) •Adatfeldolgozás fejlődése (Bioinformatika)

14 Automata DNS szekvenálás Nyers szekvencia

15 Az automata DNS szekvenálás elve ‘Színes szekvenálás` A dideoxi lánc termináláson alapul... 3’ CAAGTCACCTTG CAAG AddA Termináló helyek Szekvenáló reakcióelegy: Mind a négy dNTP Mind a négy ddNTP különböző színű fluorogén festékkel DNA polimeráz, primer

16 + index Egy szekvenálási eredmény:

17 A teljes genom 2 x 3x10 9 bp PCR bp PCR termék (2 x ) dsDNS fragmentum PCR: Egy kiválasztott DNS szakasz sokszorosítása

18

19 A Humán Genom reprezentációs formái: 1. : ‘in silico’ A Humán Genom reprezentációs formái: 1. : ‘in silico’ HGP (Human Genome Program) NCBI:National Center of Biotechnology Information

20

21 1.GenBank (NIH, Bethesda, Maryland USA) 2.Európai: EMBL-Bank (European Molecular Biology Laboratory) (EMBL's European Bioinformatics Institute, ma Angliában, régebben Heidelbergben) 3. DNA Data Bank of Japan International Nucleotide Sequence Database Collaboration : 3 fő tagja van: Az adatbázis meghaladta a -t 100 x 10 9 bp faj teljes vagy részleges genomját tartalmazza

22

23

24

25

26

27 A 21-es kromoszómán található gének listája (Entrez/Nucleotides (GenBank)

28 Keresés: DRD4 gén (Entrez/Nucleotides (GenBank)

29 A DRD4 gén (dopamin D4-es receptor) helyzete a 11-es kromoszómán (Entrez/Nucleotides (GenBank)

30 NCBI / Entrez Gene

31 NCBI / Entrez Gene keresés: DRD4 (humán)

32 Exon/intron szerkezet Környező gének publikációk

33 Keresés betegségre: „Hypercholesterolemia” (Entrez/Nucleotides (GenBank)

34 Keresés betegségre: OMIM Online Mendelian Inheritance in Man

35 OMIM keresés: hypercholesterolemia

36 A Humán Genom reprezentációs formái: 2. : Bakteriális kolóniákban A Humán Genom reprezentációs formái: 2. : Bakteriális kolóniákban BAC klónok Minden klónozott darab helye ismert FISH (fluorescent in situ hybridization) STS (short tagged sequence) Egyedi szekvenciák, klón azonosítók (genom) EST (expressed sequence tag) Egyedi szekvenciák a cDNS könyvtárakból Markerek

37 Mit lehet kiolvasni a DNS szekvenciákból?

38 Kb. 20, ,000 fehérje kódoló gén (sokkal kevesebb, mint amennyit vártunk) vagyis a gének a genom kevesebb mint 5%-át foglalják el….. A “hasznos információ” - hány génünk van? A “hasznos információ” - hány génünk van?

39

40 ??? Mi van a maradék 95% „extra (felesleg? szemét?) DNS-ben? ISMÉTLŐDŐ SZEKVENCIÁK Mi van a maradék 95% „extra (felesleg? szemét?) DNS-ben? ISMÉTLŐDŐ SZEKVENCIÁK A humán genom 45% -át “ugráló gének” (transzpozonok) alkotják •LINE (long interspread elements) 6 kb, 8500 kópia, a genom 25%-a reverz transzkripcióval szaporodik nagyon sok sérült (rövidebb, inaktív) példány •SINE (short interspred elements) bp, 1,5 millió kópia, a genom 13%-a, a LINE felhasználásával szaporodik Egyebek • Humán génduplikációk (pszeudogének) • Egyszerű ismétlések (pl. AAAAAAAAAAAAAA….)

41 A humán fehérjék domain szerkezetében igen nagy a variabilitás Hozzávetőleges adatok: A legtöbb exon bp hosszú 7-9 exon/gén A humán gének statisztikai adatai Exonok átlagos hossza humán Intronok átlagos hossza humán intron: bp Humán Domain-ek száma a fehérjékben

42 Gén és fehérje indexek ‘Orvos-biológiai ‘Periódusos rendszer’ A humán gének listája A humán fehérjék listája

43 Fehérje adatbázisok: HPRF

44 Orvosi alkalmazások 1. Öröklődő betegségekért felelős gének azonosítása Legalább 30 betegséget azonosítottak 2000-ben: pl. •Teljes színvakság (CNGA3 gén) (cGMP függő csatorna) Monogénes rendszerek: Poligénes rendszerek:“association studies”

45 Cumulative Pace of Disease Gene Discovery ( ). The number of disease genes identified so far is 1,485. Data provided by Online Mendelian Inheritance in Man.

46 Gyógyszeripar Új gyógyszer-támadáspontok felfedezése ‘in silicio’ Pl.: Szerotonin receptor ismert gén: 5-HT 3A új gén (homológ szekvencia): 5-HT 3B A kettő együtt alkot egy hatékony szerotonin receptort Pl.: Szekvenciaelemek, melyekre ismert gyógyszerek hatnak Van-e hasonló szekvencia a névtelen gének között ??? Új fehérjék, melyekre hatnak az ismert gyógyszerek

47 Hogyan tovább?

48

49

50 1999: Mouse Genome Sequencing Network, NIH (2003) Nature, 2001 oct. (413)

51

52


Letölteni ppt "A humán genom projekt Mol. biol. módszerek 1. Dr. Sasvári Mária."

Hasonló előadás


Google Hirdetések