Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

The Human Genome Project A humán gén projekt

Hasonló előadás


Az előadások a következő témára: "The Human Genome Project A humán gén projekt"— Előadás másolata:

1

2

3 The Human Genome Project A humán gén projekt

4 Február 2001: Humán genom jelentős része kész Public HGP Celera Genomics T h i s j u s t i n, A p r i l 1 4, : T h e H u m a n G e n o m e i s c o m p l e t e d - a g a i n Június, 2004 Január, 2005

5 Kiket szekvenáltak meg?  Celera: 21 kevert etnikumú donor (kor, nem önmeghatározott etnikum); ml vér; a férfiaktól 5 adag sperma 6 hét alatt. 2 férfit és 3 nőt választottak ki: 1 afrikai, 1 kínai, 1 spanyol- mexikói, 2 kaukázusi (szempontok: diverzitás, minőség).  HGP 2 centrum gyűjtötte a donorokat, hasonló elvek alapján

6 Milyen információkat nyújt a humán genom szekevenciája? A számok alapján • Három milliárd bázist tartalmaz(A, C, T, and G). • Egy átlagos gén 3000 bazisból áll, a méret változó, a leghosszabb humán gén a dystrophin 2.4 millió bázissal. • Az összes gének száma 30,000—sokkal kevesebb mint az előzetes becslés 80, ,000. • 99.9%-a az összes nukleotidnak pontosan ugyanaz minden emberben. • A gének 50%-nak ismeretlen a funkciója. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

7 A humán genom tulajdonságai  Legnagyobb gén: Dystrophin (DMD): 2,2Mb ( bp)  Leghosszabb kódoló szekvencia: titin: bp, < aminosav), leghosszabb exon: titin: bp  Géngazdag kromoszómák: 17,19,22  Leggazdagabb: 19-es: 63,8Mb = 1468 gén (Ensembl): 23 gén/Mb  Génszegény kromoszómák: 4,13,18,X, Y (összesen 104 gén; 1,8 gén/Mb)  Intronok 98,12% GT 5’ végén és AG 3’ végén;  35-40% alternative splicing (egy génből több fehérje)

8 Milyen információkat nyújt a humán genom szekevenciája? A gének elrendeződése • A humán genom géngazdag régióiban G-C tartalom dominál. • A gén szegény régiók gazdagok A-T építő kövekben. • A gének random oszlanak el a kromoszómákon és közöttük sok nem kódoló DNS található. • A géngazdag régiók határán akár 30,000 C és G bázis tartalmu ismétlődő szigetek választják el a géneket az un. Junk DNS-től, feltehető szabályozó szereppel. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

9 Milyen információkat nyújt a humán genom szekevenciája? The Wheat from the Chaff • A genom keveebb mint 1%-a kódol fehérjéket. • Fehérjéket nem kódoló ismétlődő szekvenciák teszik ki ("junk DNA") a humán genom legkevesebb 50%-t. • A repetitiv szekvenciáknak nincs direkt funkciója, de befolyásolják a kromatin strukturáját és dinamikáját. Átrendezik a genomot, új gének keletkezésében vesznek részt.. • A humán genomban több az ismétlődő szekvencia (50%), mint az utilapu füben (11%), a gilisztában (7%), vagy a légyben (3%). U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

10 Milyen információkat nyújt a humán genom szekevenciája? A humán és más genomok összehasonlítása • Az emberi genomhoz képest más genomok sokkal egyenletesebb gén eloszlást mutatnak. • Az emberben háromszor több féle fehérje van mint pl. a légyben. Ez alternatív splicing és poszt-transzlációs módosítások eredménye. Egy génről több fehérje termék is keletkezhet. • A fehérje családok száma hasonló a giliszta, légy, vagy növényekben találhatókhoz. De egy családban több egyed van, különösen a fejlődésban és az immunitásban szereplő fehérjék között.. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

11 Milyen információkat nyújt a humán genom szekevenciája? Variációk és eltérések • A genomban kb. három millió egy-bázis mutáció van (SNP) • A csírasejtekben található SNP-k aránya 2:1 a spermiumok és petesejtek közt. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

12 • Gének száma, funkciói • Genek regulációja • DNS szekvencia szervezettsége Kromoszómák felépítése, organizációja • Nem kódoló DNS szerkezete, típusai, felépítése, szerepe • Génexpresszió, transzláció, módosítások koordinálása • Fehérje kölcsönhatások • Gén funkciók jóslása és kisérletes bizonyítása • Az evolúció • Fehérjék evolúciója (structure and function) • Proteomes (total protein content and function) in organisms • Az SNP-k(single-base DNA variations among individuals) szerepe betegségekben • Disease-susceptibility prediction based on gene sequence variation • Multigenes betegségekben szerepet játszó gének vizsgálata • A genetika, genomika fejlesztése A jövő kérdései: U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

13 Genome Sequencing Approaches

14 A HUGO Project hierarchikus rendszere A HUGO Project hierarchikus rendszere Nagy felbontás Alacsony felbontás Citogenetikai térképek (kromoszómasáv) Átfedő fragmentumok klónozása Restrikciós térképezés Szekvenálás

15 Minden kezdet nehéz J. Watson, a HGP első elnöke Első cél: minél több marker kifejlesztése (átlagos távolság: bp legyen) Marker: Egyszer előfordul ó (‘unique’) szekvencia ( bp) Eredmény: db marker

16 A hierarchikus rendszer felépítése bp darabok Izolált kromoszómák feldarabolása ritkán vágó restrikciós endonukleázokkal A keletkezett darabok klónozása  BAC (Bacterial Arteficial Chromosome) könyvtár létrehozása

17 A hierarchikus rendszer felépítése BAC könyvtár: átfedő darabok Következő lépések: 1. restrikciós térképezés 2. Sorba-rendezés 3. A minimális számú BAC klón kiszelektálása

18 A végek szekvenálása GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT BAC könyvtárból fág könyvtár kb bp (BAC) kb bp darabok (átfednek) A szekvenciák sorba rakása GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT

19 Összerakás

20 Craig Venter Celera: A “géppisztoly” módszer 2000 bp és bp darabok A végek szekvenálása, összerakás: AAGGACTTATG____________________GGACACAGGTTATGG GACTTA_____CGTTGGA GAGAGGACACA________________CGTTATATTG

21 Dideoxynucleoside Sequencing

22 A G C T 5’-AAACCAGGCCGATAAGGTACTACACGAAAAAAA-3’ dATP dCTP dTTP dGTP + ddATP 32 ddCTP 32 ddTTP 32 ddGTP 32 TTTGGTCCGGCTATTCCATGATGTGCTTTTTTT TTGGTCCGGCTATTCCATGATGTGCTTTTTTT TGGTCCGGCTATTCCATGATGTGCTTTTTTT GGTCCGGCTATTCCATGATGTGCTTTTTTT GTCCGGCTATTCCATGATGTGCTTTTTTT TCCGGCTATTCCATGATGTGCTTTTTTT CCGGCTATTCCATGATGTGCTTTTTTT CGGCTATTCCATGATGTGCTTTTTTT GGCTATTCCATGATGTGCTTTTTTT GCTATTCCATGATGTGCTTTTTTT CTATTCCATGATGTGCTTTTTTT TATTCCATGATGTGCTTTTTTT ATTCCATGATGTGCTTTTTTT Step 1. Extend complementary sequence using “free” nucleotides with limiting amounts of radioactive “terminating” nucleotides. Step 2. Run product out on a electrophoresis gel. Step 3. Place gel against radiographic film, develop. TTTTTTT AAACCAGGCCGATAAGGTACTACACGAAAAA | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | DNA Sequencing (old method)

23 Dideoxynucleoside Sequencing(new)

24 Dideoxynucleoside Sequencing

25 Oligonucleotide Array Synthesis  Photolithograp hy  In situ synthesis  Photolabile protective groups (photomaskin g(

26 High-Density Oligonucleotide Arrays Chee M. Assessing genetic information with high-density oligonucleotide arrays. Science 1996

27 FISH: Chromosomal Translocations

28 DNA Microarray Technology: A Technical Perspective

29 From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA). The fluorescent intensity of each feature correlates with the expression level of the gene (mRNA) in the samples under investigation.

30 The Key to Nucleic Acid Detection is “Sequence-Specific Affinity” CAGTAACGGTTCAGTAACGGTT 5’ 3’ GTCATTGCCAAGTCATTGCCAA 5’ 3’ Microarray-Based Assays (The Basics)

31 “PROBE” is DNA spotted (attached) to the solid substrate (non-fluorescent glass slide). “TARGET” is the fluorescence labeled cDNA representation of the mRNA and is hybridized to the probe. Microarray-Based Assays (The Basics)

32 ...GCUACGAUUGCAACGCCCGAAUGGUUACCAAAAAAAAAAA... dCTP dATP dTTP dGTP How does a DNA microarray detects gene activity? Reverse Transcription makes cDNA from gene sequence… AAAAAAAAAAAAAAAA mRNA TTTTTTTTTTTGGTAACCCCCCCATTGGGGTTGAATGTAG cDNA TTTTTTTTTTTGGTAACCCCCCCATTGGGGTTGAATGTAG

33 2-Color System... RNA from Normal TissueRNA from Cancer or Drug Treated Tissue dCTP Reverse Transcription

34 2-Color System... Detection

35 2-Color Laser Scanner

36 P450 Induction Study Adult Male Sprague-Dawley rats ( g) were dosed daily with the following compounds (or vehicle control), and sacrificed at 1-day and 4-days of treatment. Livers were resected and flash-frozen for subsequent microsomal preparation and RNA isolation. DRUG (dose)Expected P450 Induced  -naphthoflavone (40mg/kg IP)1A1, 1A2 2) Dexamethasone (50mg/kg IP)3A 3) Isoniazid (100 mg/kg IP)2E1 4) Phenobarbital (20 mg/kg IP)2B1 RNA was analyzed using the Rat P450 microarray, microsomes were assayed for the anticipated P450 activity.

37 -naphthoflavone (40mg/kg IP) 1A1 enzyme activity is expressed as ratio of drug treated over control (ethoxyresorufin to hydroxyresorufin, nmol/min/mg protein). Day 1: 11.4 (= 2.73 / 0.24) Day 4: 13.5 (= 2.30 / 0.17) 1A1 1-Day 1A1 Fold Change above Control

38 -naphthoflavone (40mg/kg IP) 1A2 enzyme activity is expressed as ratio of drug treated over control (methoxyresorufin to hydroxyresorufin, nmol/min/mg protein). Day 1: 4.0 (= 0.12 / 0.03) Day 4: 8.5 (= 0.17 / 0.02) 1A2 4-Day 1A2 Methylcholanthrene-inducible P450d Fold Change above Control

39 Transzgenikus állatok

40 Transzgenikus egér készítése

41 Lehet egy teljesen új gént is bevinni GFP transzgén

42 A transzgénikus állat legyen • Nagyobb • Rezisztensebb • Szebb, finomabb, vagy amit akartok

43 A "knockout mouse" A knockout egérben az adott gén mindkét allélja helyettesített inaktivált allélal. Ezt általában homolog rekombinációval érik el Ezt több lépéses szelektív tenyésztés követi, míg a célgén mindkét példánya inaktivált ill. ki van ütve mindkét példánya inaktivált ill. ki van ütve

44 When an investigator wants to replace one allele with an engineered construct but not affect any other locus in the genome, then the method of choice is homologous recombination. To perform homolgous recombination, you must know the DNA sequence of the gene you want to replace. With this information, it is possible to replace any gene with a DNA construct of your choosing. The next step is to design and fabricate the DNA construct you want to insert into the chromosome in place of the wild-type allele. This construct may contain any DNA sequence of your choosing which means you can insert different alleles (both functional and non-functional ones), different genes or reporter genes (e.g. antibiotic resistance or green fluorescent protein). Regardless of what you want to insert, you must include some flanking DNA that is identical in sequence to the targeted locus

45 In addition to the positive selection marker (e.g. antibiotic resistance) often a negative selection marker (e.g. thymidine kinase, tk) is added to the replacement vector. The negative marker is outside the region of sequence similarity between the vector and the targeted locus. The engineered construct is added to cells which contain the targeted gene of interest. By mechanisms that are poorly understood but are similar to what occurrs during meiosis and mitosis when homolgous chromosomes align along the metaphase plane, the engineered construct finds the targeted gene and recombination takes place within the homolgous (meaning identical in this case) sequences. Once the cells have performed their part of the procedure, the end result is a new piece of DNA inserted into the chromosome. The rest of the genome is unaltered but the single targeted locus has been replaced with the engineered construct and some of its flanking DNA.

46 If the targeting vector aligns in a non-homologous region of the genome, then recombination is random and the negative selection marker may become incorporated into the genome. The final product of non-homologous recombination can survive positive (antibiotic) selection. However, there is a drug called gancyclovir that will kill any cell that contains the tk gene. So cells undergoing homologous recombination are grown in antibiotic to select for recombination and gancyclovir to kill any cells that successfully conducted non-homologous recombination. The positive and negative selection markers are incorporated into chromosome so gancyclovir will kill cells with modified chromosomes.

47 A knockout mouse has had both alleles of a particular gene replaced with an inactive allele.. Isolate developing embryo at blastocyst stage. This embryo is from a strain of mice with gray fur. 1. Remove embryonic stem cells from gray-fur blastocyst. Grow stem cells in tissue culture. 2. Transfect stem cells with homologous recombination construct. Select for homologous recombination by growing stem cells in neomycin and gancyclvir.

48 Implant several chimeric blastocysts into pseudo-pregnant, white fur mouse. Mother will give birth to a range of mice. Some will be normal white fur mice but others will be chimeric mice. Chimeric mice have many of their cells from the original white fur blastocyst but some of their cells will be derived from recombinant stem cells. Fur cells from recombinant stem cells produce gray patches which are easily detected.

49 Mate the chimeric mice with wild-type white fur mice. If the gonads of the chimeric mice were derived from recombinant stem cells, all the offspring will have gray fur. Every cell in gray mice are heterozygous for the homologous recombination. Mate heterozygous gray mice (+/ H) and genotpye the gray offspring. Identify homozygous recombinants (H / H) and breed them to produce a strain of mice with both alleles knocked out. The pure breeding mouse strain is a "knockout mouse".

50 Short Contents | Full ContentsShort ContentsFull ContentsOther booksOther NCBINCBI Navigation About this book21. Genetic manipulation of animals21.1. An overview of genetic manipulation of animals21.2. The creation and applications of transgenic animals21.3. Use of mouse embryonic stem cells in gene targeting and gene trapping21.4. Creating animal models of disease using transgenic technology and gene targeting21.5. Manipulating animals by somatic cell nuclear transfer Further reading Human Molecular Genetics Genetic manipulation of animals Use of mouse embryonic stem cells in gene targeting and gene trapping Figure Gene targeting using the Cre-loxP recombination system can be used to inactivate a gene in a desired cell type. (A) Illustration of a standard homologous recombination method using mouse ES cells, in which three loxP sites are introduced along with a marker M at a target locus A (typically a small gene or an internal exon which if deleted would cause a frameshift mutation). Subsequent transfection of a Cre recombinase gene and transient expression of this gene results in recombination between the introduced loxP sites to give different products. Type I recombinants are used to generate mice in which the target locus is flanked by loxP sites. Such mice can be mated with previously constructed transgenic mice (B) which carry an integrated construct consisting of the Cre recombinase gene linked to a tissue-specific promoter. Offspring which contain both the loxP-flanked target locus plus the Cre gene will express the Cre gene in the desired tissue type, and the resulting recombination between the loxP sites in these cells results in tissue-specific inactivation of the target locus A. © 1999 Garland ScienceGarland Science Search This book All books PubMed

51 Leptin deficiens kövér egér


Letölteni ppt "The Human Genome Project A humán gén projekt"

Hasonló előadás


Google Hirdetések