Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd.

Hasonló előadás


Az előadások a következő témára: "Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd."— Előadás másolata:

1 Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd fázisú szintézis: hordozó: controlled pore glass (CPG), vagy polisztirol Mind DNS mind RNS szintetizálható mind a két módszerrel

2 2% DCA/DCM di-MeO Tr I 2 / H 2 O N tetrazol Ac 2 O < 1 % > 99 % újabb ciklus hordozó di-MeO Tr O O O O B 2 O O O O P O O hordozó B 1 NC di-MeO Tr O O O O B 2 O O O O P O B 1 NC O O O AcO hordozó B 1 di-MeO Tr O O O O hordozó B 1 O O O OH B 1 di-MeO Tr O O O O NC P O N B 2 Oligonukleotid szintézis:foszforamidit módszer O O O OH hordozó B 1

3 Oligonukleotid szintézis: H-FOSZFONÁT MÓDSZER Előny: az oxidációt elég a végén elvégezni, vagy – igény szerint – el sem kell  töltés nélküli molekula  Könnyebben átmegy a sejtfalon/membránon

4 OLIGONUKLEOTIDOK UTÓKEZELÉSE I. - Deblokkolás: védőcsoportok eltávolítása, hordozóról való lehasítás - liofilezés, sómentesítés A lúg hatására lehasad: - védőcsoportok a bázisokról -  -cianoetil csoport a fosztátról - oligo a hordozóról

5 - méret szerinti elválasztás, PAGE, vagy HPLC (sokszor nem szükséges) OLIGONUKLEOTIDOK UTÓKEZELÉSE II. Ioncserés kromatográfiaHidrofób kromatográfia a DMT csoporton keresztül - kvantitálás bázis  (µmol * cm/cm 3 ) dA15.4 dG11.7 dC 7.5 dT 8.8 átlagosan  = 10 (µmol * cm)/cm 3

6 OLIGONUKLEOTIDOK: FELHASZNÁLÁSI TERÜLETEK -primerek: DNS, RNS szekvenálás, PCR, mutagenezis -linkerek: mesterséges hasítóhelyek bevitele -adapterek: különböző (nem-kompatibilis) ragadós DNS végek összekötése, esetleg hasítóhely bevitelével -hibridizációs próbák, DNS diagnosztika -antiszensz oligonukleotidok, génterápia -gén darabok - egyéb, pl. DNS affinitásoszlopok készítése, stb.

7 Polimeráz láncreakció I. Termostabil DNS polimeráz, Taq, Pfu, Vent, Pwo stb. Soknak nincs 3’  5’ exonukleáz aktivitása  “A” túlnyúló

8 Polimeráz láncreakció II.

9 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI  klónozás, megfelel ő DNS szakaszok kinyerése, esetenként degenerált primerekkel  DNS szekvenálás, pl. ThermoSequenase  mutagenezis  szálspecifikus próbák el ő állítása  diagnosztika  fert ő zések kimutatására  mutáns allélek kimutása

10 BELSŐ (NESTED) PCR 1. PCR 2. PCR 2 primer párt használunk  nagyobb specificitás, a nemspecifikus termékek eltűnése  költségesebb

11 INVERZ PCR A géneket környező régiók kiamplifikálkására Általában a gén szekvenciája részben vagy teljesen ismert  primer pár tervezhető AA hasítás 'A' restrikciós enzimmel AA önligálás A PCR 'A'

12 REVERZ TRANSZKRIPCIÓ KAPCSOLT PCR (RT-PCR) mRNS antiszensz primer reverz transzkripció reverz transzkriptázzal AMV: avian mieloblastosis virus RT MMLV: Moloney murine leukémia vírus RT Tth: Thermus thermophilus, Mn 2+ jelenlétében cDNS szensz primer PCR RT+RT-gK bp Gének szerveződésének vizsgálatára

13 REVERZ TRANSZKRIPCIÓ KAPCSOLT KVANTITATÍV PCR Az RNS preparátumnak DNS mentesnek kell lennie exponenciális rész lineráris szakasz plató ciklus szám termék Hagyományos PCR-rel igen nehéz a termék mennyiségének a meghatározása

14 T 50°C 95°C 72°C DenaturálásHibiridizációDNA szintézis Real-time PCR Denaturálás : SYBRGreenI: fluorescens SYBRGreenI

15 Real-time PCR reakció analízise 280ng28ng2.8ng0.28ng0.028nggDNA: Kalibráció ismert mennyiségű genomiális DNS-sel reprodukálhatóság ismeretlen mennyiségű templát cDNA-sel.

16 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI I. - FERTŐZÉSEK KIMUTATÁSA minden élőlény genetikai anyaga nukleinsav, ez tartalmaz specifikus szekvenciaelemeket  speciálisan tervezett primerek segítségével PCR a termék megjelenése fertőzésre utal

17 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI II. MUTÁCIÓK KIMUTATÁSA A normális C gén mutáns 5'3' A C 5'5' A5'5' PCR egészséges nincs termék beteg A C 5'5' 3' C5'5' PCR egészséges nincs termék beteg

18 GÉNSZINTÉZIS STRATÉGIÁK 1. Szintetikus DNS fragmentek összeállítása átfedő oligomerekből 1. fragment2. fragment 3. fragment 1+2. fragment fragment hátrány: drága, mind a két szálat meg kell szintetizálni

19 2. Fragment összeállítás primer-templát módszerrel 5’ 3’ Klenow, dNTP Több verzió is erre az enzimatikus feltöltési elvre alapszik. 2.a. Hajtű módszer Klenow, dNTP emésztés restrikciós endonuklázokkal ligálás 5’ 3’

20 hasított vektor polimerizációKlenow, dNTP ligálás transzformálás hibridizálás, enzimatikus feltöltés 5’ 3’ átfedő szintetikus oligonukleotidok hasított vektor 5’ 3’ közvetlen transzformálás Híd ligálás 2. c. Fragment összeállítás a javító mechanizmus (gap repair) kihasználásával

21 sejtmembrán fehérjék mRNS sejtmag Kromoszómális DNS oligonukleotid citolplazma Cél molekula:fehérjemRNSDNS oligonukleotid iránya a leolvasással megegyezõ v. kettõsszálú a leolvasással ellentétes a leolvasással megegyezõ RNS DNS duplex triplex köcsönhatásfehérje-DNSRNS-DNS hibrid/ RNáz H Hoogsteen féle triplex Gátlástranszkripciós szabályozás transzlációtranszkripció Génexpresszió szabályozása szintetikus oligonukleotidokkal

22 Triplex képződésének kölcsönhatásai homopurin homopirimidin szekvenciáknál

23 MUTAGENEZIS - in vivo gének elrontására,vagy módosítására Random mutagenezis  találomra létrehozott mutációk  mutagén anyagok: UV, kemikáliák, radioaktív sugárzás  PCR: a hőstabil polimerázok átírási hűsége rosszabb  mutagén törzsek  transzpozon mutagenezis Irányított mutagenezis Adott helyen - deléciók inszerciók léterhozása - pont mutációk létrehozása

24 Ar1Ar2 ori Ar2 Ar1 Ar2 oriV Gének irányított szétroncsolása interpozon mutagenezis poláris hatás vad típus mutáns oriT oriV: szűk gazdaspecificitás Ar: antibiotikum rezisztencia

25 Ar1 ori Ar1 oriV vad típus mutáns poláris hatás ? Deléciós mutagenezis a leolvasási keret sértése nélül oriV: szűk gazdaspecificitás oriT Ar: antibiotikum rezisztencia

26 Gének irányított mutagenezise a dut/ung rendszer alapján Dut: dUTPase Ung: uracil-N-glikoziláz Ne épüljön be dezoxiuracil A DNS-be in vitro szintézis, Klenow pontmutációk!

27 QUICK CHANGE MUTAGENEZIS (STRATAGENE)

28 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: mutagenezis random: a Taq polimeráz átírási hűsége rosszabb, hibák épülnek be és amplifikálódnak 1-2 hiba 1 kb hosszon Mn 2+ vagy nukleotid analógok (inozin) növelik a mutációs rátát in vitro evolúció irányított: XhoI MrMr MfMf O1 O2 O1-M r M f –O21 st PCR-s BamHI CO2 O1 XhoI BamHI 2 nd PCRO1 – O2 digest with XhoI and BamHI ligate into XhoI – BamHI digested vector

29 FEHÉRJE TERMELTETÉS Legyen az prokariótavagyeukarióta természetesvagyszintetikus vad típusúvagymutáns VAN GÉNÜNK:

30 FEHÉRJE TERMELTETŐ RENDSZEREK PROKARIÓTÁK E. coli ismert, Bármilyen fehérje, feltéve, ha - nem túl nagy - nem túl kicsi - nem túl hidrofób - nincs túl sok cisztein benne szekréciós rendszere minimális Bacillus subtilis jól ismert, ha nem is annyira, mint az E. coli van szekréciós rendszere EUKARIÓTÁK élesztő gyorsan szaporodó eukarióta sejtvonal, sok ismeretanyag viszonylag könnyű kezelhetőség poszttranszlációs modifikációk lehetősége emlős sejtvonalak  minden fajta fehérje termeltethető bennük  tranziens expressziós rendszerek viszonylag gyors, de korlátozott lehetôségek,  stabil expressziós rendszerek  hosszú, fáradságos optimalizálást igényel

31 Escherichia coli HÁTRÁNYOK   általában nem szekretál  a sejten belül redukáló atmoszféra diszulfid hidak kialakulása gátolt  az eukariota poszttranszlációs módosítások általában nem megvalósíthatóak  nem alakul ki a megfelelő aktiv szerkezet, rossz folding ELŐNYÖK óriási mennyiségű ismeretanyag könnyű kezelhetőség, gyors növekedési sebesség, viszonylag olcsó médium nagy mennyiségű biomassza gazdaságos előállítása ismert szelekciós rendszerek legtöbb expressziós rendszer

32 STRATÉGIÁK TÚLTERMELTETÉSRE  a fehérje a teljes növekedési fázis alatt expresszálódik  nagy sejttömeg elérése után a fehérje visszanyerése  nem igazán használatos, toxicitási problémák miatt KONSTITUTÍV PROMÓTER  a promoter represszált állapotban van a növekedés egy bizonyos fázisáig  valamilyen indukcióval derepresszió  további növesztés  fehérje visszanyerése  legáltalánosabban használt stratégia  toxicitás sok esetben megoldható INDUKÁLT TERMELTETÉS

33 PROKARIÓTA EXPRESSZIÓS VEKTOR ELEMEI TT SZF SDkódoló szekvencia Pr TSZE TTGACAN 17 TATAAT 5’ UAAGGAGGN (3-11) START kodon AUG GUG UUG STOP kodon UAAU UGA UAG ARORI  GS Pr: promóter TT: transzkripciós terminációs szignál, SZF: szabályozó fehérje,, TSZE: transzlációt szabályozó elemek, SD: Shine-Dalgarno szekvencia, AR: antibiotikum rezisztencia, ORI: replikációs origo GS: gazdasejt

34 FEHÉRJERNS transzláció transzkripció DNS transzkripciós szinten poszt-transzkcripciós szinten (mRNS degradáció, protein stabilitás, stb.) A génexpresszió szabályozása

35 Különböző faktorok relatív hatása a fehérje termeltetésre E. coli-ban  Promóter indukálhatóságkb x  Gazdasejt kb x  A mRNS 5’ struktúrájakb. 100 x  Transzlációkb. 100 x  növekedési sebességkb. 50 x (mRNS stabilitás)

36 TRANSZKRIPCIÓ  Iniciáció fehérje termeltetés során a legfontosabb  Elongáció mivel a gén belsejében van, nem manipulálható  Termináció a transzkripció befejezése, a transzkripciós apparátus túlterhelésének elkerülésére

37 A transzkripció iniciációja prokariótákban 5’ 3’ promóter 5’ 3’ 5’ 3’ 5’ sigma faktor RNS polimeráz holoenzim k1k1 k -1 k2k2 k -2 5’ 3’ Ha k 1 >> k -1, akkor a polimeráz holoenzim nagyon erősen kötődik a promóter szekvenciához, a polimeráz nehezen tudja elindítani a polimerizációs reakciót. Tehát a transzkript mennyisége csökken, habár in vitro a promóter és a holoenzim közötti kapcsolat erős. ?? /`/`  NTD  CTD RNS polimeráz alegységek: ,  `, , , 

38  70 promoter szekvencia: -10 and -35 régiók

39 A génexpresszió tanulmányozása különböző módszerekkel különböző szinteken fehérje érése transzláció transzkripció Enzim aktivitás mérés mRNS detektálása Riportergén riporter fehérje aktivitás  promóter aktivitás Western blot fehérje detektálása A vizsgált operon promóter

40 ELECTRO MOBILITY SHIFT ASSAY (EMSA) I.  más néven gél retardációs assay  a DNS-t, amely feltételezhetően fehérjét köt, megjelöljük  jelölés lehet végen, szálon belül, egyszálon, kétszálon, kötési kísérletben a DNS kétszálú!  a DNS ne legyen től hosszú bp, minél hosszabb a DNS, annál több nem specifikus reackió történik  lehet tiszta fehérje vagy fehérje populáció DNS jelölés DNS kötő fehérje összekeverés nem kötődikkötődik Natív poliakrilamid gél -: fehérje nélkül, +: fehérjével összekeverve nem kötődik - + kötődik - + nem specifikusan kötődik - +

41 DNázI FOOT PRINT I. DNS hossz 100 – 200 bp DNS jelölés szigorúan a végén, szálspecifikusan mind a két jelölt szállal meg kell csinálni a kötési kísérletben a DNS kétszálú DNázI G A+G C+T C D denaturáló poliakrilamid gélelektroforézis Maxam-Gilbert létra DNázI hasítás * **************** ** ** **************** ** **

42 DNázI FOOT PRINT II. DNázI G A+G C+T C D- D+ Maxam-Gilbert létra DNázI hasítás -: fehérje nélkül +: fehérje jelenlétében hiperszenzitív hely (HSH) HSH ****** ** ******** ****** **********

43 UV KERESZTKÖTÉS (CROSS LINKING) Ismeretlen DNS kötő fehérjék molekulatömegének becslésére 1. A DNS szálat szálon belül jelöljük, és Br-dUMP-t építünk be (a Br-dUMP nem zavarja a kötődést) : Br MS? EMSA UV fény  kivágás, izolálás   DNázI kezelés a fehérje DNS komplex kötés kovalens lesz jelölt fehérje SDS-PAGE minta marker

44 - Northern-blot és hibridizáció - reverz-transzkripció kapcsolt kvantitatív PCR - korrekt, de belső összehasonlító standardokat igényel A mRNS mennyiségének meghatározása

45 Regulátor régió riporter gén (pl. lacZ) Promóter Riporter gének alkalmazása  -galaktozidáz (LacZ) SEJT  -galaktozidáz aktivitás mérés feltételezi, hogy nincs poszt-transzkripciós szabályozás, és az enzim specifikus aktivitása is minden mintára egyforma aktivitás mérés kiküszöbölése GFP: Green Fluorescent Protein, gerjesztve floureszkál a kapott aktivitást illetve szignált normálni kell a sejt vagy protein mennyiségére

46 Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés B)regulon: gének szétszórva a genomban, közös regulátor operon regulon

47 A TRANSZKRIPCIÓS SZABÁLYOZÁS FŐBB GLOBÁLIS STRATÉGIÁI PROKARIÓTÁKBAN inaktív aktivátor inaktív aktív aktivátor indukálószer represszor inaktív represszor derepresszált KATABOLIKUS derepresszált aktív represszor indukálószer represszált BIOSZINTETIKUS KATABOLIKUS BIOSZINTETIKUS indukált aktív aktivátor inaktív aktivátor indukálószer RNS polimeráz inaktív represszor RNS polimeráz represszált negatív szabályozás pozitív szabályozás indukció represszió

48 FNR - fumarát nitrát reduktáz regulátor - citoplazmatikus szenzor-regulátor - dimer[4Fe-4S] 2+  DNS-t köt - monomer[2Fe-2S] 2+  inaktív - aenaerob respirációra (+) vagy (-) hatás - pO 2 1 mbar alatt - TTGAT-N 4 -ATCAA konszenzus szekvencia - [2Fe-2S] 2+  [4Fe-4S] 2+ (in vitro) Cys, Fe, DTT, NifS - Pseudomonas: ANR; Bacillus: FNR Rhodobacter sphaeroides: FnrL O2O2 FNR red FNR ox

49 Komponensek - egy szenzor kináz és egy DNS kötő regulátor - E. coli genom 2% - kb 50 különböző 2 komponensű rendszer - 3 alcsalád: OmpR, FixJ és NtrC Két komponensű szabályozó rendszerek

50 P szenzor kináz fehérje DNS kötő fehérje P ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs FelvevőDNS kötő FelvevőDNS kötő szignál transzfoszforiláció DNS A bakteriális kétkomponensű szabályozó rendszerek működése elve

51 ArcA/B - aerobic respiratory control - ArcB (szenzor kináz): sejt redox és metabolikus helyzet (elektron transzport változást érzékel) - ArcA(citoplazmatikus regulátor): ArcB foszforilálja  aktív - pO mbar között - TATTTaa konszenzus szekvencia - Haemophilus: ArcA - E. coli homológ gén: OmpR O2O2 P P ArcB ArcA  P ArcA

52 A lac operon kettős szabályozása  laktóz (allolaktóz) indukál  glükóz gátol, cAMP/CAP-n keresztül  glükóz/egyéb cukor kiiktatása tápból nem célszerű   glükóz szabályozás kikapcsolása

53 trp AATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCA tac AATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGA lacUV5 CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA lac CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGGTGTGTGGA “-35” “-10” lac (és trp) alapú promóterek lacUV5  lac promóter UV erősség

54 A transzkripciós faktorok sokoldalúak…. Ara C -Ara P BAD represszió +Ara P BAD indukció RNS polimeráz P BAD AraC P BAD

55 A transzkripció és a transzláció párhuzamosan megy baktériumokban

56 protein antranilát szintáz indol-glicerin szintáz triptofán szintáz A triptofán operon szerkezete

57 Termináció – attenuáció – trp operon

58 mRNS degradáció baktériumokban mRNS stabilitás prokariótákban néhány perc, eukariótákban órás nagyságrend előbb utóbb minden RNS lebomlik mRNS stabilitását meghatározó faktorok: - belső, saját szerkezet - a környezet hatására bekövetkezett változás a degradációs apparátusban puf operon (a fotoszintetikus komplex komponensei) Rhodobacter capsulatus degradációja O 2 hatására felgyorsul policisztronos rendszerek esetén az alegységek arányának szabályozása a mRNS régióinak eltérő stabilitásával

59 A R. capsulatus puf mRNS régióinak stabilitása

60 - transzkripció gátlása (pl. rifampicin)t=0 időpontban, majd  időközönként mintavétel és RNS analízis (Northern..) -a degradációs mechanizmusban szerepet játszó gének deléciója, hőmérséklet érzékeny expressziós változatának kialakítása - in vitro transzkripció jelölt nukleotidokkal, a kapott termék inkubációja a sejtextraktummal különböző ideig, majd analízis gélelektroforézissel, kvantitálás mRNS degradáció baktériumokban, vizsgálati módszerek

61 mRNS-eket stabilizáló (védő) tényezők 1.5’ végi trifoszfát 2.RNS struktúra 3.riboszóma

62 A degradoszóma felépítése

63 A degradoszóma komponensei II. PNPase (polynucleotide phosphorylase)  78 kDa alegységek, homotrimer  3'  5' foszfát függő processzív exonukleáz,  ribonukleotid difoszfátok képződnek  poliadenilációs aktivitás Polyphosphate Kinase (PPK)  funkció: ATP regeneráció, polifoszfát (inhibiálja a degradációt) eltávolítás  ppk mínusz törzs : megnövekedett mRNS stabilitás  80 kDa alegységek, homotetramer, sok van E. coli-ban

64 A degradoszóma komponensei III. Helikáz  ATP függő DEAD (Asp-Glu-Ala-Asp) helikáz  50 kDa RhlB  a másodlagos struktúrák kinyitása szétroncsolása ATP hiányában a hurokstruktúra stabil marad

65 Egyéb – mRNS degradációjában résztvevő – enzimek RNáz II  70 kDa monomer,  a sejt 3'  5' exoribonukláz aktivitásának 90%-a  ribonukleotid monofoszfátok képződnek  a PNPáz-zal együttes deléciója letális !!! PolyA polimerázok PAPI 53 kDa PAPII 35 kDa  poliadeniláció, bázis hosszú  mRNS instabilitás

66 A mRNS degradáció mechanizmusa

67 Transzláció prokariótákban

68 Shine - Dalgarno szekvencia GGAGG a tökéletes komplementer a 16S rRNS 3'végéhez, pl. GAAG GGAG mutáció (maltóz operon) 10 x növekedés a termék mennyiségében a SD szekvencia hosszának növelése nem feltétlenül növeli a transzlációt Hasonlóan a promóterekhez, túl erős kötődés a SD szekvencia és a 16S rRNS 3’ vége között a transzlációt gátolhatja. Transzlációs start kodon kodon gyakoriság AUG91 % GUG8 % UUG1 %

69 Az AUG előtti szekvenciák 20x-os különbség UAU, CUU >> UUC, UCA, AGG ("-1 triplet) G-k kerülendők Az AUG utáni szekvenciák 30x -oskülönbségek lehetnek AAA(Lys) > AAG(Lys) > UUU(Phe), AUC/A(Val), GUA(Ala)... A természetes gének között is az AAA(Lys) és GCU(Ala) transzlációs szabályozás a 2. kodonnal +10 régió AT gazdag

70 Távolság a start kodon és a SD között - meglehetősen érzékeny, általban bázispár megengedett. - Génfüggő, egy gén esetén általában csak kicsit változhat. A köztes szekvencia összetétele “A” jó, ha van (2x-es stimulus),“C” mindegy “U” a "-4"-es pozícióban hatékony “G” gátol (3x-os gátlás) Upstream nemtranszlálódó szekvencia Nem nagyon vizsgált, de kell, mert eltávolítása megszünteti a transzlációt (ld lac). Minimum 10 bp kell. Esetleg valamilyen faktorok kötődnek hozzá.

71 Kodon felhasználási preferencia Bár a kodonok gyakorlatilag univerzálisak, a különböző sejtféleségek különböző gyakorisággal használják az azonos aminosavakat kódoló tripleteket. Ha a termeltetendő fehérje génjének kodon használata nagyon eltér a gazdasejtétől, akkor meg kell szintetizáltatni a gént a gazda sejt preferenciájának megfelelően. Alternatív megoldás: a gazdasejt kodon preferenciájának megváltoztatása, ritka kodonokhoz tartozó tRNS gének bevitelével

72 [gbbct]: 50 CDS's (13879 codons) Sphingomonas paucimobilis AmAcid Codon Number /1000 Fraction Gly GGG Gly GGA Gly GGT Gly GGC Glu GAG Glu GAA Asp GAT Asp GAC Val GTG Val GTA Val GTT Val GTC Ala GCG Ala GCA Ala GCT Ala GCC Arg AGG Arg AGA Ser AGT Ser AGC Lys AAG Lys AAA Asn AAT Asn AAC Met ATG Ile ATA Ile ATT Ile ATC Thr ACG Thr ACA Thr ACT Thr A CC Trp TGG End TGA Cys TGT Cys TGC End TAG End TAA Tyr TAT Tyr TAC Leu TTG Leu TTA Phe TTT Phe TTC Ser TCG Kodon felhasználási preferencia – táblázat egy adott gén esetén a kodon preferencia alapján a gén E. coli-ban, vagy élesztőben való expresszálhatósága in silico becsülhető.

73 STOP kodon UAA UGA UAG kötődő faktor RF1, RF2 RF1 RF2 UAA >> UGA, UAG Az esetek 80 %-ában: UAAU

74 PROTEOLÍZIS Abnormális fehérjék proteolitikus lebontási mechanizmusa E. coli-ban Abnormális fehérjék, sejten belüli aggregátumok ATP függő endoproteázok polipeptidek < 1500 Da endoproteázok peptidek aminosavak oldékony mono-, di- és tripeptidázok

75 La (Lon) a fő ATP függő proteáz  87 kDa egységekből felépülő homotetramer,  ATP és Mg 2+ függő, az ATP-áz aktivitás nem a polipeptid kötés felbontásához, hanem a degradálandó fehérjén való végiglovagláshoz kell,  in vitro 2 ATP/ peptidkötés, in vivo ez változhat, és ennél nagyobb.  hasonló fehérjék előfordulnak magasabbrendűekben is, pl. egy máj mitondriális proteáz immunológiailag keresztreaktív  abnormális fehérjék, és rövid élettartamú (pl. szabályozó fehérjék bontása)  szerin proteáz, hidrofób jellegű szekvenciáknál hasít  alapállapotban inaktív, a szubsztrát fehérje hozzákapcsolódása aktiválja,  a lon gén terméke, és a sokk fehérjékhez kapcsolódó szabályozás alatt áll:  32 faktor, ami a htpR (rpoH) gén terméke

76 inaktív proteáz (4 ADP) protein szubsztrát 4 ADP 4 ATP - Mg 2+ alloszterikus aktiválás aktív proteáz (4 ATP) 4 PO Mg 2+ Proteolitikus ciklus

77 Ti (Clp) a másik ATP függő proteáz  81 (ClpA) és 21 kDa (ClpP) alegységekből álló heterodimer, ez multimerizálódik, a natív enzim kb 700 kDa móltömegű  ATP és Mg 2+ faktorok szükségesek hidrofób részeknél hasít, de a specificitás eltér a La-tól  az alegységek külön multimerizálódnak  HtpR szabályozás alatt áll TulajdonságTi (Clp) proteázClpPClpA aktivitásfehérje degradáció ATP hidrolízis mellett peptidáz ATP független ATP-áz fehérje aktivált KofaktorMg 2+ - InhibítorMalNEt, iPr 2 P-FiPr 2 P-FMalNEt StabilizálásATP, glicerinhőstabilATP, glicerin natív méret700 kDa260 kDa160 kDa alegységek6 ClpA + 12 ClpP21 kDa81 kDa

78 FÚZIÓS FEHÉRJÉK A fúziót gén szinten hozzuk létre úgy, hogy a fúziós partnerek génjeit a megfelelő leolvasási keretben úgy klónozzuk össze, hogy az 5’ vég felőli génhez tartozó transzlációs stop kodon ne szerepeljen. Így egy polipeptidláncot kapunk, amelyben a kiinduási fehérjék egymást követő régiókként helyezkednek el. ELŐNYEI 1. Kis peptidek esetén a fúzió proteolitikus stabilitást jelenthet 2.Óriási előny a tisztítás során, affinitás oszlopok 3.szignálpeptiddel való fúzió, szekretált fehérje (limitált) 4.Az in vitro hasítás sokszor pontosabb, intaktabb N-terminális szekvenciát eredményez

79 Oldhatatlan "iclusion bodies" trpEII, vagy cII, nincs proteolízis, differenciális centrifugálással az "inclusion body" könnyen tisztítható, probléma: nem aktív fehérje pl sometostatin, inzulin A, B, ellenanyag termelés Oldható forma biológiailag aktív fehérje, affinitás oszlopon való tisztítás problémák a stabilitással, kevésbé jósolható Fúziós fehérjék oldhatósága

80 Egyéb hasznosítási lehetőségek 1. a szignál peptidekkel való fúzió előnyei (ld. később) a periplazmában, illetve az extracelluláris térben oxidatívabb környezet, diszulfid hidak kialakulása, pl. EGF, IGF A periplazmában az összfehérje 4%-a található, értelemszerűen kevesebb proteáz,könnyebb tisztítás 2.A fúzionált fehérje linkerként szolgál, és így a kívánt fehérje immobilizálható 3.funkcionális, struktúrális vizsgálatok, pl. immunológiai felhasználás alkalmasan választott fúziós partner esetén nincs szükség hasításra. 4.megfelelő hasítás után az intakt fehérje tetszőleges biokémiai, biofizikai vizsgálata

81 A fúziós fehérjék tisztításának elve I. 1. affinitás kromatográfia II. hasítás III. 2. affinitás kromatográfia tiszta fehérje fúziós partner célfehérje

82 FehérjeSzármazási helymolekulasúly (kDa)szekrécióligand  -galaktozidázEscherichia coli116-TPEG, APTG Protein AStaphylococcus aureus31+IgG Zszintetikus7+IgG CATEscherichia coli24+klóramfenikol sztreptavidinStreptomyces13+biotin PhoSEscherichia coli36+hidroxilapatit Protein GStreptococci28+albumin MBPEscherichia coli40+keményítô GSTEscherichia coli26-glutation poliargininszintetikus1-3-ioncsere poliglutamátszintetikus1-2-ioncsere polihisztidinszintetikus1-7+Ni 2+, Zn 2+, Cu 2+ Fúziós partnerfehérjék CAT: klóramfenikol-acetiltranszferáz; Z: A Protein A fehérje IgG kötô doménje; PhoS: foszfát kötô fehérje; MBP: maltóz-kötô fehérje; GST: glutation S-transzferáz; TPEG: p-aminofenil--d-tiogalaktozidáz; APTG: p-aminofenil--d-tiogalaktozid.

83 FÚZIÓS FEHÉRJÉK HASÍTÁSI MÓDOZATAI. Endopeptidázok ENZIMATIKUS ENZIMHASÍTÁSI HELY kollagenáz- Pro - Val  Gly - Pro - enterokináz- Asp - Asp - Asp - Lys  Xa faktor- Ile - Glu - Gly - Arg  trombin- Gly - Pro - Arg  tripszin- Arg, Lys  klosztripain- Arg  Ala 64 -szubtilizin- Gly - Ala - His - Arg 

84 Nómenklatúra: szekréció: az extracelluláris térbe export: az sejtmembránokba vagy a periplazmatikus térbe A fehérje szekréció Előnyei  A tisztítás sokkal egyszerűbb, esetleg folyamatos üzemű lehet  Az periplazma illetve az extracelluláris tér sokkal oxidatívabb, korrektebb protein folding  A fehérje degradáció sokkal csekélyebb mértékű, proteolitikusan stabilabb termékek

85 Fő protein transzport mechanizmusok bacteriumokban Sec útvonal: egyszerű kofaktor mentes polipeptidekre Tat útvonal: több alegységes enzimekre, amelyek kofaktorokat is tartalmaz(hat)nak transzport: a fehérje összeszerelődése után SRP, signal recognition particle, és receptora E. coli homológ: Ffh forty five homolog, FtsY Poszttranszlációs transzport Kotranszlációs transzport

86 SZIGNÁL SZEKVENCIÁK GRAM - BAKTÉRIUMOKBAN I. Standard szignál peptid COOH “N”“H”“C”  1 K vagy R hidrofób  hélix, sok A és L, nem lehet P, K, R, D, E, H, R fordulat P G hasítóhely AGSAGS AXAX semleges vagy negatív fMG fordulat AVSAVS -3 Lipoprotein szignál peptid “C” COOH “N”“H”  1 K vagy R hidrofób  hélix, sok A és L, nem lehet P, K, R, D, E, H, R hasítóhely AGAG D lipoprotein kiválasztó szignál semleges vagy negatív fM L

87 A Sec útvonal

88 A prokarióta és eukarióta transzportmechanizmusok összehasonlítása

89 Twin-arginine szignál peptid n-régióc-régióh-régió N + moderáltan hidrofób S/T-R-R-x-F-L-K n-regionc-region Sec szignál peptid h-region N erősen hidrofób + Signal sequences for targeting SRP: erősen hidrofób szignál, nem hasad le

90 A periplazmitikus hidrogenázok bioszintézise citoplazmatikus összeszerelődési modell Periplazma Citoplazma csatorna Holoenzim kofaktor(ok) prekurzor szignál peptid

91 citoplazma TatC TatB TatA membrán aktív formát felvett enzim A TAT modell


Letölteni ppt "Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd."

Hasonló előadás


Google Hirdetések