Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd.

Hasonló előadás


Az előadások a következő témára: "Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd."— Előadás másolata:

1 Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd fázisú szintézis: hordozó: controlled pore glass (CPG), vagy polisztirol Mind DNS mind RNS szintetizálható mind a két módszerrel

2 Oligonukleotid szintézis: monomerek

3 2% DCA/DCM di-MeO Tr I 2 / H 2 O N tetrazol Ac 2 O < 1 % > 99 % újabb ciklus hordozó di-MeO Tr O O O O B 2 O O O O P O O hordozó B 1 NC di-MeO Tr O O O O B 2 O O O O P O B 1 NC O O O AcO hordozó B 1 di-MeO Tr O O O O hordozó B 1 O O O OH B 1 di-MeO Tr O O O O NC P O N B 2 Oligonukleotid szintézis:foszforamidit módszer O O O OH hordozó B 1

4 Oligonukleotid szintézis:foszforamidit módszer, alternatív kép

5 Oligonukleotid szintézis: H-FOSZFONÁT MÓDSZER Előny: az oxidációt elég a végén elvégezni, vagy – igény szerint – el sem kell  töltés nélküli molekula  Könnyebben átmegy a sejtfalon/membránon

6 Egy-két automata szintetizátor

7 OLIGONUKLEOTIDOK UTÓKEZELÉSE I. - Deblokkolás: védőcsoportok eltávolítása, hordozóról való lehasítás - liofilezés, sómentesítés A lúg hatására lehasad: - védőcsoportok a bázisokról -  -cianoetil csoport a fosztátról - oligo a hordozóról

8 - méret szerinti elválasztás, PAGE, vagy HPLC (sokszor nem szükséges) OLIGONUKLEOTIDOK UTÓKEZELÉSE II. Ioncserés kromatográfiaHidrofób kromatográfia a DMT csoporton keresztül - kvantitálás bázis  (µmol * cm/cm 3 ) dA15.4 dG11.7 dC 7.5 dT 8.8 átlagosan  = 10 (µmol * cm)/cm 3

9 OLIGONUKLEOTIDOK: FELHASZNÁLÁSI TERÜLETEK -primerek: DNS, RNS szekvenálás, PCR, mutagenezis -linkerek: mesterséges hasítóhelyek bevitele -adapterek: különböző (nem-kompatibilis) ragadós DNS végek összekötése, esetleg hasítóhely bevitelével -hibridizációs próbák, DNS diagnosztika -antiszensz oligonukleotidok, génterápia -gén darabok - egyéb, pl. DNS affinitásoszlopok készítése, stb.

10 Linkerek rövid, önkomplemeter oligonukleotidok, amelyek saját magukhoz hibridizálva olyan tompa végű, kettősszálú DNS-t képeznek, amely tartalmazza egy tetszőleges restrikciós endukleáz felismerő helyét: Restrikciós hely bevitelére alkalmas BamHI CGGATCCG EcoRI GGAATTCC PstI GCTGCAGC ADAPTEREK szintetikus kettősszálú oligonukleotidok, amelyek végei kompatibilisek különböző restrikciós endukleázokkal végzett emésztések során képződő végekkel. Esetenként valamilyen restrikciós endonukleáz felismerőhelyét tartalmazhatja. EcoRI – SmaI...5'AATTCCCGGG 3‘ 3’GGGCCC 5’ EcoRI SmaI Rövid adapterek: egyik vég ragadós, a másik tompa. Hosszú adapterek: két ragadós vég között egy harmadik restrikiós endonukleáz felismerõhelye 5' GATCCGGGCCCTGTTAGAGCT 3' 3' GCCCGGGACAATC 5' pl. BamHI (ApaI) SacI

11 Primerek szintetikus oligodeoxinukleotidok, amelyek iniciációs pontjaiként szolgálnak a templát függő DNS polimerázok számára. Univerzális primerek: a gyakorlatban elterjedt vektorok klónozó helyének környékére tervezett primerek. Specifikus primerek: az adott feladatnak megfelelően szintetizált speciális szekvenciájú oligonukleotidok.

12 Polimeráz láncreakció I. Termostabil DNS polimeráz, Taq, Pfu, Vent, Pwo stb. Soknak nincs 3’  5’ exonukleáz aktivitása  “A” túlnyúló

13 Polimeráz láncreakció II.

14 A POLIMERÁZ LÁNC REAKCIÓ MÓDOZATAI - belső PCR, specificitás növelése belső primerek használatával egy elsődleges PCR terméken - egy specifikus primert használó PCR + primer adapter limitált információ esetén - LM PCR, ligálás közvetített PCR, kromoszóma metiláltsági térképezésére - inverz PCR, szegélyező szekvenciák izolálására - “farkazott PCR” ld. cDNS izolálás - RT PCR, reverz transzkripció kapcsolt PCR, ld. cDNS - kvantitatív PCR, mRNS mennyiségének becslésére

15 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI  klónozás, megfelel ő DNS szakaszok kinyerése, esetenként degenerált primerekkel  DNS szekvenálás, pl. ThermoSequenase  mutagenezis  szálspecifikus próbák el ő állítása  diagnosztika  fert ő zések kimutatására  mutáns allélek kimutása

16 BELSŐ (NESTED) PCR 1. PCR 2. PCR 2 primer párt használunk  nagyobb specificitás, a nemspecifikus termékek eltűnése  költségesebb

17 EGY SPECIFIKUS PRIMEREN ALAPULÓ PCR GÉN'A' hasítás 'A' enzimmel GÉN'A' ligálás primer/adapterrel 'A' GÉN'A' PCR 'A' Potenciális melléktermék: elkerülésére megoldás: a primer adaptor feleslegben való alkalmazása

18 LM PCR, ligálás közvetített PCR, kromoszóma metiláltsági térképezésére GÉN'A' hasítás 'A' enzimmel GÉN'A' ligálás primer/adapterrel 'A' GÉN'A' PCR 'A' ha “A” metiláció érzékeny  nincs termék ha “A” izoskizomerje érzéketlen metilációra  van termék

19 INVERZ PCR A géneket környező régiók kiamplifikálkására Általában a gén szekvenciája részben vagy teljesen ismert  primer pár tervezhető AA hasítás 'A' restrikciós enzimmel AA önligálás A PCR 'A'

20 REVERZ TRANSZKRIPCIÓ KAPCSOLT PCR (RT-PCR) mRNS antiszensz primer reverz transzkripció reverz transzkriptázzal AMV: avian mieloblastosis virus RT MMLV: Moloney murine leukémia vírus RT Tth: Thermus thermophilus, Mn 2+ jelenlétében cDNS szensz primer PCR RT+RT-gK bp Gének szerveződésének vizsgálatára

21 REVERZ TRANSZKRIPCIÓ KAPCSOLT KVANTITATÍV PCR Az RNS preparátumnak DNS mentesnek kell lennie exponenciális rész lineráris szakasz plató ciklus szám termék Hagyományos PCR-rel igen nehéz a termék mennyiségének a meghatározása

22 T 50°C 95°C 72°C DenaturálásHibiridizációDNA szintézis Real-time PCR Denaturálás : SYBRGreenI: fluorescens SYBRGreenI

23 Real-time PCR reakció analízise 280ng28ng2.8ng0.28ng0.028nggDNA: Kalibráció ismert mennyiségű genomiális DNS-sel reprodukálhatóság ismeretlen mennyiségű templát cDNA-sel.

24 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: klónozás

25 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: DNS szekvenálás templát DNS ddATP/dNTP PCR egy primerrel ddA terminálódott láncok száma lineárisan sokszorozódik

26 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: mutagenezis random: a Taq polimeráz átírási hűsége rosszabb, hibák épülnek be és amplifikálódnak 1-2 hiba 1 kb hosszon Mn 2+ vagy nukleotid analógok (inozin) növelik a mutációs rátát in vitro evolúció irányított: XhoI MrMr MfMf O1 O2 O1-M r M f –O21 st PCR-s BamHI CO2 O1 XhoI BamHI 2 nd PCRO1 – O2 digest with XhoI and BamHI ligate into XhoI – BamHI digested vector

27 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI I. - FERTŐZÉSEK KIMUTATÁSA minden élőlény genetikai anyaga nukleinsav, ez tartalmaz specifikus szekvenciaelemeket  speciálisan tervezett primerek segítségével PCR a termék megjelenése fertőzésre utal

28 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI II. MUTÁCIÓK KIMUTATÁSA A normális C gén mutáns 5'3' A C 5'5' A5'5' PCR egészséges nincs termék beteg A C 5'5' 3' C5'5' PCR egészséges nincs termék beteg

29 +C RR M 60 o C62 o C64 o C66 o C Diagnosztika optimalizálás XhoI BamHI

30 Ligáz láncreakció 5’5’3’A 5’5’ T A 5’5’ T 5’5’ 5’5’ A 5’5’ T A 5’5’ T 5’5’ 5’5’ A 5’5’ T A 5’5’ T 5’5’ A 5’5’ T 5’5’ A 5’5’ T 5’5’ 5’5’ A 5’5’ T A 5’5’ T 5’5’ T 5’5’ T 5’5’ A 5’5’ A 5’5’ denaturáció, hibridizáció denaturáció, hibridizáció ligálás, termostabil ligázzal 4 primeres, A PCR-t nem tudta kiszorítani

31 Ligálás és a PCR kombinálása

32 GÉNSZINTÉZIS STRATÉGIÁK 1. Szintetikus DNS fragmentek összeállítása átfedő oligomerekből 1. fragment2. fragment 3. fragment 1+2. fragment fragment hátrány: drága, mind a két szálat meg kell szintetizálni

33 2. Fragment összeállítás primer-templát módszerrel 5’ 3’ Klenow, dNTP Több verzió is erre az enzimatikus feltöltési elvre alapszik. 2.a. Hajtű módszer Klenow, dNTP emésztés restrikciós endonuklázokkal ligálás 5’ 3’

34 hasított vektor polimerizációKlenow, dNTP ligálás transzformálás hibridizálás, enzimatikus feltöltés 5’ 3’ átfedő szintetikus oligonukleotidok hasított vektor 5’ 3’ közvetlen transzformálás Híd ligálás 2. c. Fragment összeállítás a javító mechanizmus (gap repair) kihasználásával

35 A humán szérum albumin HSA szintézise 1864 bp hosszú géne, 60 kDa méretű fehérje. Magyar projekt, svéd megbízásból SZBK, Biotechnika Rt. 5 kutatója Eleinte még manuális oligo szintézis A szintézis oka: élesztőben termeltetni  vérpótló szer A gént négy kb egyenlő részre osztottál, mindegyik kb 450 bp hosszú, Ezeket klasszikus klónozással illesztették össze minden darabot bp-os oligokból illesztettek össze 5’5’3’

36 Negyed HSA szintézis stragégiája pN GGGCC pC G CTTAA OH CCCGGG G CCTAG AATTC G pNGGGCCC CCCGGG G CTTAA OH GGGCCC C GGATCN CCTAGN HSA1 AATTC G pC G CTTAA OH CCCGGG pNGGGCCC CCCGGG G CTTAA OH HSA1 pN GGGCC HSA2 1. ligálás 2. tompítás 3. ligálás ligálás ApaI-EcoRI adapter EcoRI-ApaI hasítás ligálás GGGCCC CCCGGG G CTTAA GGATCN CCTAGN HSA1 AATTC G AATTC G GCGC GGATCN CCTAGN HSA1 GGGCCC CCCGGG G CTTAA HSA2 AATTC G


Letölteni ppt "Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd."

Hasonló előadás


Google Hirdetések