Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

1 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció.

Hasonló előadás


Az előadások a következő témára: "1 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció."— Előadás másolata:

1 1 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció DNS Gén transzkripció, RNS szerkesztés RNS degradáció fehérje transzláció, poszttranszlációs módosítás metabolomika

2 2 A BIOLÓGIAI INFORMÁCIÓ HORDOZÓ MEGFEJTÉSE GENOMIKA A teljes genetikai állomány szekvenciájának meghatározása, A szekvenciákon elhelyezkedő funkcionális régiók számítógépes jóslása: annotálás

3 3 Funkcionális genomika RNS szinten TRANSZKIPTOMIKA

4 Egy DNS chip kísérlet folyamatábrája

5 5 A chipek kiértékelése, eredménye

6 6 Funkcionális genomika fehérje szinten PROTEOMIKA

7 Proteomika EgyTipikus protokol Minta elő Izoelektromos fókuszálás SDS PAGE Láthatóvá tétel Kép analízis Protein pötty kivágás tömegspektrometria Protein azonosítás

8 8

9 9 Proteomika: az elválasztástól az azonosításig

10 Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd fázisú szintézis: hordozó: controlled pore glass (CPG), vagy polisztirol Mind DNS mind RNS szintetizálható mind a két módszerrel

11 Oligonukleotid szintézis: monomerek

12 2% DCA/DCM di-MeO Tr I 2 / H 2 O N tetrazol Ac 2 O < 1 % > 99 % újabb ciklus hordozó di-MeO Tr O O O O B 2 O O O O P O O hordozó B 1 NC di-MeO Tr O O O O B 2 O O O O P O B 1 NC O O O AcO hordozó B 1 di-MeO Tr O O O O hordozó B 1 O O O OH B 1 di-MeO Tr O O O O NC P O N B 2 Oligonukleotid szintézis:foszforamidit módszer O O O OH hordozó B 1

13 Néhány automata szintetizátor

14 OLIGONUKLEOTIDOK UTÓKEZELÉSE I. - Deblokkolás: védőcsoportok eltávolítása, hordozóról való lehasítás - liofilezés, sómentesítés A lúg hatására lehasad: - védőcsoportok a bázisokról -  -cianoetil csoport a fosztátról - oligo a hordozóról

15 - méret szerinti elválasztás, PAGE, vagy HPLC (sokszor nem szükséges) OLIGONUKLEOTIDOK UTÓKEZELÉSE II. Ioncserés kromatográfiaHidrofób kromatográfia a DMT csoporton keresztül - kvantitálás bázis  (µmol * cm/cm 3 ) dA15.4 dG11.7 dC 7.5 dT 8.8 átlagosan  = 10 (µmol * cm)/cm 3

16 OLIGONUKLEOTIDOK: FELHASZNÁLÁSI TERÜLETEK -primerek: DNS, RNS szekvenálás, PCR, mutagenezis -linkerek: mesterséges hasítóhelyek bevitele -adapterek: különböző (nem-kompatibilis) ragadós DNS végek összekötése, esetleg hasítóhely bevitelével -hibridizációs próbák, DNS diagnosztika -antiszensz oligonukleotidok, génterápia -gén darabok - egyéb, pl. DNS affinitásoszlopok készítése, stb.

17 Linkerek rövid, önkomplemeter oligonukleotidok, amelyek saját magukhoz hibridizálva olyan tompa végű, kettősszálú DNS-t képeznek, amely tartalmazza egy tetszőleges restrikciós endukleáz felismerő helyét: Restrikciós hely bevitelére alkalmas BamHI CGGATCCG EcoRI GGAATTCC PstI GCTGCAGC ADAPTEREK szintetikus kettősszálú oligonukleotidok, amelyek végei kompatibilisek különböző restrikciós endukleázokkal végzett emésztések során képződő végekkel. Esetenként valamilyen restrikciós endonukleáz felismerőhelyét tartalmazhatja. EcoRI – SmaI...5'AATTCCCGGG 3‘ 3’GGGCCC 5’ EcoRI SmaI Rövid adapterek: egyik vég ragadós, a másik tompa. Hosszú adapterek: két ragadós vég között egy harmadik restrikiós endonukleáz felismerõhelye 5' GATCCGGGCCCTGTTAGAGCT 3' 3' GCCCGGGACAATC 5' pl. BamHI (ApaI) SacI

18 Primerek szintetikus oligodeoxinukleotidok, amelyek iniciációs pontjaiként szolgálnak a templát függő DNS polimerázok számára. Univerzális primerek: a gyakorlatban elterjedt vektorok klónozó helyének környékére tervezett primerek. Specifikus primerek: az adott feladatnak megfelelően szintetizált speciális szekvenciájú oligonukleotidok.

19 Polimeráz láncreakció I. Termostabil DNS polimeráz, Taq, Pfu, Vent, Pwo stb. Soknak nincs 3’  5’ exonukleáz aktivitása  “A” túlnyúló

20 Polimeráz láncreakció II.

21 A POLIMERÁZ LÁNC REAKCIÓ MÓDOZATAI - belső PCR, specificitás növelése belső primerek használatával egy elsődleges PCR terméken - egy specifikus primert használó PCR + primer adapter limitált információ esetén - LM PCR, ligálás közvetített PCR, kromoszóma metiláltsági térképezésére - inverz PCR, szegélyező szekvenciák izolálására - “farkazott PCR” ld. cDNS izolálás - RT PCR, reverz transzkripció kapcsolt PCR, ld. cDNS - kvantitatív PCR, mRNS mennyiségének becslésére

22 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI  klónozás, megfelelő DNS szakaszok kinyerése, esetenként degenerált primerekkel  DNS szekvenálás, pl. ThermoSequenase  mutagenezis  szálspecifikus próbák előállítása  diagnosztika  fertőzések kimutatására  mutáns allélek kimutása

23 BELSŐ (NESTED) PCR 1. PCR 2. PCR 2 primer párt használunk  nagyobb specificitás, a nemspecifikus termékek eltűnése  költségesebb

24 INVERZ PCR A géneket környező régiók kiamplifikálkására Általában a gén szekvenciája részben vagy teljesen ismert  primer pár tervezhető AA hasítás 'A' restrikciós enzimmel AA önligálás A PCR 'A'

25 REVERZ TRANSZKRIPCIÓ KAPCSOLT PCR (RT-PCR) mRNS antiszensz primer reverz transzkripció reverz transzkriptázzal AMV: avian mieloblastosis virus RT MMLV: Moloney murine leukémia vírus RT Tth: Thermus thermophilus, Mn 2+ jelenlétében cDNS szensz primer PCR RT+RT-gK bp Gének szerveződésének vizsgálatára

26 REVERZ TRANSZKRIPCIÓ KAPCSOLT KVANTITATÍV PCR Az RNS preparátumnak DNS mentesnek kell lennie exponenciális rész lineráris szakasz plató ciklus szám termék Hagyományos PCR-rel igen nehéz a termék mennyiségének a meghatározása

27 T 50°C 95°C 72°C DenaturálásHibiridizációDNA szintézis Real-time PCR Denaturálás : SYBRGreenI: fluorescens SYBRGreenI

28 Real-time PCR reakció analízise 280ng28ng2.8ng0.28ng0.028nggDNA: Kalibráció ismert mennyiségű genomiális DNS-sel reprodukálhatóság ismeretlen mennyiségű templát cDNA-sel.

29 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: klónozás

30 A POLIMERÁZ LÁNC REAKCIÓ FELHASZNÁLÁSI TERÜLETEI: mutagenezis random: a Taq polimeráz átírási hűsége rosszabb, hibák épülnek be és amplifikálódnak 1-2 hiba 1 kb hosszon Mn 2+ vagy nukleotid analógok (inozin) növelik a mutációs rátát in vitro evolúció irányított: XhoI MrMr MfMf O1 O2 O1-M r M f –O21 st PCR-s BamHI CO2 O1 XhoI BamHI 2 nd PCRO1 – O2 digest with XhoI and BamHI ligate into XhoI – BamHI digested vector

31 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI I. - FERTŐZÉSEK KIMUTATÁSA minden élőlény genetikai anyaga nukleinsav, ez tartalmaz specifikus szekvenciaelemeket  speciálisan tervezett primerek segítségével PCR a termék megjelenése fertőzésre utal

32 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI II. MUTÁCIÓK KIMUTATÁSA A normális C gén mutáns 5'3' A C 5'5' A5'5' PCR egészséges nincs termék beteg A C 5'5' 3' C5'5' PCR egészséges nincs termék beteg

33 Ligálás és a PCR kombinálása

34 GÉNSZINTÉZIS STRATÉGIÁK 1. Szintetikus DNS fragmentek összeállítása átfedő oligomerekből 1. fragment2. fragment 3. fragment 1+2. fragment fragment hátrány: drága, mind a két szálat meg kell szintetizálni

35 2. Fragment összeállítás primer-templát módszerrel 5’ 3’ Klenow, dNTP Több verzió is erre az enzimatikus feltöltési elvre alapszik. 2.a. Hajtű módszer Klenow, dNTP emésztés restrikciós endonuklázokkal ligálás 5’ 3’

36 hasított vektor polimerizációKlenow, dNTP ligálás transzformálás hibridizálás, enzimatikus feltöltés 5’ 3’ átfedő szintetikus oligonukleotidok hasított vektor 5’ 3’ közvetlen transzformálás Híd ligálás 2. c. Fragment összeállítás a javító mechanizmus (gap repair) kihasználásával

37 sejtmembrán fehérjék mRNS sejtmag Kromoszómális DNS oligonukleotid citolplazma Cél molekula:fehérjemRNSDNS oligonukleotid iránya a leolvasással megegyezõ v. kettõsszálú a leolvasással ellentétes a leolvasással megegyezõ RNS DNS duplex triplex köcsönhatásfehérje-DNSRNS-DNS hibrid/ RNáz H Hoogsteen féle triplex Gátlástranszkripciós szabályozás transzlációtranszkripció Génexpresszió szabályozása szintetikus oligonukleotidokkal

38 Triplex képződésének kölcsönhatásai homopurin homopirimidin szekvenciáknál

39 Antiszensz oligonukleotidok lehetséges célszekvenciái a mRNS-en 1)exon-intron határhoz, slicing gátlás 2)Az 5’ sapka régióhoz 3)Transzlációs iniciációs régióhoz 4)Génen belüli régióhoz Kapcsolódó oligonukleotidok Elsődleges hatásmechanizmus: Az endogén RNázH leemészti a DNS:RNS hibrid RNS szálát

40 2% DCA/DCM di-MeO Tr I 2 / CS 2 N tetrazol Ac 2 O < 1 % > 99 % újabb ciklus hordozó di-MeO Tr O O O O B 2 O O O O P O S hordozó B 1 NC di-MeO Tr O O O O B 2 O O O O P O B 1 NC O O O AcO hordozó B 1 di-MeO Tr O O O O hordozó B 1 O O O OH B 1 di-MeO Tr O O O O NC P O N B 2 Oligonukleotid szintézis:foszforamidit módszer O O O OH hordozó B 1

41 PEPTID NUKLEINSAVAK (PNA) Nincs cukorfoszfát gerinc, ehelyett peptid kötéssel összekapcsolt lánc van Specifikus Stabil PNA T10-LysTTTTTTTTTT-Lys PNA SV40-LysATTTTCTTCATTTTTTCTTC-Lys Ma már külön könyv van a PNA- alkalmazásairól

42 MUTAGENEZIS - in vivo gének elrontására,vagy módosítására Random mutagenezis  találomra létrehozott mutációk  mutagén anyagok: UV, kemikáliák, radioaktív sugárzás  PCR: a hőstabil polimerázok átírási hűsége rosszabb  mutagén törzsek  transzpozon mutagenezis Irányított mutagenezis Adott helyen - deléciók inszerciók léterhozása - pont mutációk létrehozása

43 Ar1Ar2 ori Ar2 Ar1 Ar2 oriV Gének irányított szétroncsolása: interpozon mutagenezis poláris hatás vad típus mutáns oriT oriV: szűk gazdaspecificitás Ar: antibiotikum rezisztencia

44 Ar1 ori Ar1 oriV vad típus mutáns poláris hatás ? Deléciós mutagenezis a leolvasási keret sértése nélül oriV: szűk gazdaspecificitás oriT Ar: antibiotikum rezisztencia

45 QUICK CHANGE MUTAGENEZIS (STRATAGENE)

46 FEHÉRJE TERMELTETÉS Legyen az prokariótavagyeukarióta természetesvagyszintetikus vad típusúvagymutáns VAN GÉNÜNK:

47 FEHÉRJE TERMELTETŐ RENDSZEREK PROKARIÓTÁK E. coli ismert, Bármilyen fehérje, feltéve, ha - nem túl nagy - nem túl kicsi - nem túl hidrofób - nincs túl sok cisztein benne szekréciós rendszere minimális Bacillus subtilis jól ismert, ha nem is annyira, mint az E. coli van szekréciós rendszere EUKARIÓTÁK élesztő gyorsan szaporodó eukarióta sejtvonal, sok ismeretanyag viszonylag könnyű kezelhetőség poszttranszlációs modifikációk lehetősége emlős sejtvonalak  minden fajta fehérje termeltethető bennük  tranziens expressziós rendszerek viszonylag gyors, de korlátozott lehetőségek,  stabil expressziós rendszerek  hosszú, fáradságos optimalizálást igényel

48 Escherichia coli HÁTRÁNYOK   általában nem szekretál  a sejten belül redukáló atmoszféra diszulfid hidak kialakulása gátolt  az eukarióta poszttranszlációs módosítások általában nem megvalósíthatóak  nem alakul ki a megfelelő aktiv szerkezet, rossz folding ELŐNYÖK óriási mennyiségű ismeretanyag könnyű kezelhetőség, gyors növekedési sebesség, viszonylag olcsó médium nagy mennyiségű biomassza gazdaságos előállítása ismert szelekciós rendszerek legtöbb expressziós rendszer

49 STRATÉGIÁK TÚLTERMELTETÉSRE  a fehérje a teljes növekedési fázis alatt expresszálódik  nagy sejttömeg elérése után a fehérje visszanyerése  nem igazán használatos, toxicitási problémák miatt KONSTITUTÍV PROMÓTER  a promoter represszált állapotban van a növekedés egy bizonyos fázisáig  valamilyen indukcióval derepresszió  további növesztés  fehérje visszanyerése  legáltalánosabban használt stratégia  toxicitás sok esetben megoldható INDUKÁLT TERMELTETÉS

50 PROKARIÓTA EXPRESSZIÓS VEKTOR ELEMEI TT SZF SDkódoló szekvencia Pr TSZE TTGACAN 17 TATAAT 5’ UAAGGAGGN (3-11) START kodon AUG GUG UUG STOP kodon UAAU UGA UAG ARORI  GS Pr: promóter TT: transzkripciós terminációs szignál, SZF: szabályozó fehérje,, TSZE: transzlációt szabályozó elemek, SD: Shine-Dalgarno szekvencia, AR: antibiotikum rezisztencia, ORI: replikációs origo GS: gazdasejt

51 FEHÉRJERNS transzláció transzkripció DNS transzkripciós szinten poszt-transzkripciós szinten (mRNS degradáció, protein stabilitás, stb.) A génexpresszió szabályozása

52 Különböző faktorok relatív hatása a fehérje termeltetésre E. coli-ban  Promóter indukálhatóságkb x  Gazdasejt kb x  A mRNS 5’ struktúrájakb. 100 x  Transzlációkb. 100 x  növekedési sebességkb. 50 x (mRNS stabilitás)

53 TRANSZKRIPCIÓ  Iniciáció fehérje termeltetés során a legfontosabb  Elongáció mivel a gén belsejében van, nem manipulálható  Termináció a transzkripció befejezése, a transzkripciós apparátus túlterhelésének elkerülésére

54 A transzkripció iniciációja prokariótákban 5’ 3’ promóter 5’ 3’ 5’ 3’ 5’ sigma faktor RNS polimeráz holoenzim k1k1 k -1 k2k2 k -2 5’ 3’ Ha k 1 >> k -1, akkor a polimeráz holoenzim nagyon erősen kötődik a promóter szekvenciához, a polimeráz nehezen tudja elindítani a polimerizációs reakciót. Tehát a transzkript mennyisége csökken, habár in vitro a promóter és a holoenzim közötti kapcsolat erős. ?? /`/`  NTD  CTD RNS polimeráz alegységek: ,  `, , , 

55  70 promoter szekvencia: -10 and -35 régiók

56 Bakteriális  faktorok

57 Különböző gének expresszióját különböző szigma faktorok befolyásolják gén expresszió változás  Morfológiai & fiziológiás változások  Adaptáció / Védekezés tápelvonás, Stressz, Vasra éheztetés, sejtsűrűség, Felületi adházió Transzkripciós faktorok (Szigma)

58 Két  faktor felépítése

59 A génexpresszió tanulmányozása különböző módszerekkel különböző szinteken fehérje érése transzláció transzkripció Enzim aktivitás mérés mRNS detektálása Riportergén riporter fehérje aktivitás  promóter aktivitás Western blot fehérje detektálása A vizsgált operon promóter

60 ELECTRO MOBILITY SHIFT ASSAY (EMSA) I.  más néven gél retardációs assay  a DNS-t, amely feltételezhetően fehérjét köt, megjelöljük  jelölés lehet végen, szálon belül, egyszálon, kétszálon, kötési kísérletben a DNS kétszálú!  a DNS ne legyen től hosszú bp, minél hosszabb a DNS, annál több nem specifikus reackió történik  lehet tiszta fehérje vagy fehérje populáció DNS jelölés DNS kötő fehérje összekeverés nem kötődikkötődik Natív poliakrilamid gél -: fehérje nélkül, +: fehérjével összekeverve nem kötődik - + kötődik - + nem specifikusan kötődik - +

61 ELECTRO MOBILITY SHIFT ASSAY (EMSA) II.  a mobilitás eltolódás inkább a komplex méretét jellemzi, a kölcsönhatás errősségét nem  a kölcsönhatás erősségét a nem kötöt DNS, és a kötésben levő DNS jelének intenzitása jellemzi minél kevesebb fehérje okoz erős jelet az eltolódott sávban annál erősebb a kölcsönhatás titrálás fehérje mennyiségre hozzáadott fehérje mennyiség nő  SUPERSHIFT ASSAY - ha van tippünk, hogy milyen fehérje kötődik - és van rá specifikus ellenanyagunk nem kötődikkötődikellenanyag is kötődik : fehérje nélkül, +: csak fehérje hozzáadása, ++: fehérje és ellenanyag hozzáadása a DNS - fehérje kölcsönhatás erősségéről ad felvilágosítást, nem a képződött mRNS mennyiségéről

62 DNázI FOOT PRINT I. DNS hossz 100 – 200 bp DNS jelölés szigorúan a végén, szálspecifikusan mind a két jelölt szállal meg kell csinálni a kötési kísérletben a DNS kétszálú DNázI G A+G C+T C D denaturáló poliakrilamid gélelektroforézis Maxam-Gilbert létra DNázI hasítás * **************** ** ** **************** ** **

63 DNázI FOOT PRINT II. DNázI G A+G C+T C D- D+ Maxam-Gilbert létra DNázI hasítás -: fehérje nélkül +: fehérje jelenlétében hiperszenzitív hely (HSH) HSH ****** ** ******** ****** **********

64 UV KERESZTKÖTÉS (CROSS LINKING) Ismeretlen DNS kötő fehérjék molekulatömegének becslésére 1. A DNS szálat szálon belül jelöljük, és Br-dUMP-t építünk be (a Br-dUMP nem zavarja a kötődést) : Br MS? EMSA UV fény  kivágás, izolálás   DNázI kezelés a fehérje DNS komplex kötés kovalens lesz jelölt fehérje SDS-PAGE minta marker

65 - Northern-blot és hibridizáció - reverz-transzkripció kapcsolt kvantitatív PCR - korrekt, de belső összehasonlító standardokat igényel A mRNS mennyiségének meghatározása

66 In vitro transzkripció Regulátor G mentes kazetta régió (3-400 bp) transzkripcionálisan aktív sejt vagy sejtmagi extraktum + ATP, CTP,  32 P-UTP, a képződött radioaktív RNS analizise denaturáló PAGE-n. csak a fenti bp-os fragmentum fog látszani, a többi tartalmaz G-t  ezek transzkirpciója leáll mennyiségi becslés: denzitometriásan, vagy PhosphorImager-rel Promóter elsősorban transz szabályozó elemek hatásának vizsgálatára alkalmas

67 Regulátor régió riporter gén (pl. lacZ) Promóter Riporter gének alkalmazása  -galaktozidáz (LacZ) SEJT  -galaktozidáz aktivitás mérés feltételezi, hogy nincs poszt-transzkripciós szabályozás, és az enzim specifikus aktivitása is minden mintára egyforma aktivitás mérés kiküszöbölése GFP: Green Fluorescent Protein, gerjesztve floureszkál a kapott aktivitást illetve szignált normálni kell a sejt vagy protein mennyiségére

68 Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés B)regulon: gének szétszórva a genomban, közös regulátor operon regulon

69 A TRANSZKRIPCIÓS SZABÁLYOZÁS FŐBB GLOBÁLIS STRATÉGIÁI PROKARIÓTÁKBAN inaktív aktivátor inaktív aktív aktivátor indukálószer represszor inaktív represszor derepresszált KATABOLIKUS derepresszált aktív represszor indukálószer represszált BIOSZINTETIKUS KATABOLIKUS BIOSZINTETIKUS indukált aktív aktivátor inaktív aktivátor indukálószer RNS polimeráz inaktív represszor RNS polimeráz represszált negatív szabályozás pozitív szabályozás indukció represszió

70 A transzkripciós faktorok és aDNS közötti specifikus kölcsönhatás csgD: NNEIARSLFISENTVKTH LY merR: IGEVALLCDINPVTLRAWQR Hélix-turn-hélix (HTH) Motívumok: luxR: SWDISKILGCSERTVTFHLT lehet a faktor N vagy C terminálisán, a másik végen szokott lenni a ligand, kofaktor kötő régió

71 BAKTERIÁLIS TRANSZKRIPCIÓS FAKTOROK FŐBB CSALÁDJAI AraC családAraC, MelR, RhaS, RhaR, SoxS LysR családLysR, OxyR, MetR, CysB Crp családCrp, Fnr MerR családSoxR Két komponensűNarL, OmpR, Arc szabályozó család Lac represszor családLacI, GalR MetJ családMetJ Faktor család Tagok

72 Aktiváció a gén expresszióban I. Kölcsönhatás: -  CTD-nel (CRP) -  70 4-es régiójával ( cI aktivátor) -  NTD-nel (CRP) -  alegységgel (DnaA) -  ’ alegységgel (N4 single-stranded DNA kötő fehérje) -  CTD-nel és  70 4-es régiójával (FNR) Positive activation of gene expression Virgil A Rhodius, Stephen JW Busby Current Opinion in Microbiology 1998, 1:

73 Positive activation of gene expression Virgil A Rhodius, Stephen JW Busby Current Opinion in Microbiology 1998, 1: Aktiváció a gén expresszióban II. Promóter konformáció megváltoztatása: - “-35” és “-10” régió azonos oldalra kerül (MerR, SoxR) - DNS visszahajlik és az aktiváló cis szekvencia RNAP fölé kerül - DNS konformáció változást indukál (FIS, IHF)

74 DNS-hajlító fehérje (pl. IHF) Specifius kötőhely Távoli aktivátor helyek segítséget igényelnek

75 Transzkripció repressziója baktériumokban

76 FNR - fumarát nitrát reduktáz regulátor - citoplazmatikus szenzor-regulátor - dimer[4Fe-4S] 2+  DNS-t köt - monomer[2Fe-2S] 2+  inaktív - aenaerob respirációra (+) vagy (-) hatás - pO 2 1 mbar alatt - TTGAT-N 4 -ATCAA konszenzus szekvencia - [2Fe-2S] 2+  [4Fe-4S] 2+ (in vitro) Cys, Fe, DTT, NifS - Pseudomonas: ANR; Bacillus: FNR Rhodobacter sphaeroides: FnrL O2O2 FNR red FNR ox

77 Komponensek - egy szenzor kináz és egy DNS kötő regulátor - E. coli genom 2% - kb 50 különböző 2 komponensű rendszer - 3 alcsalád: OmpR, FixJ és NtrC Két komponensű szabályozó rendszerek

78 P szenzor kináz fehérje DNS kötő fehérje P ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs FelvevőDNS kötő FelvevőDNS kötő szignál transzfoszforiláció DNS A bakteriális kétkomponensű szabályozó rendszerek működése elve

79 ArcA/B - aerobic respiratory control - ArcB (szenzor kináz): sejt redox és metabolikus helyzet (elektron transzport változást érzékel) - ArcA(citoplazmatikus regulátor): ArcB foszforilálja  aktív - pO mbar között - TATTTaa konszenzus szekvencia - Haemophilus: ArcA - E. coli homológ gén: OmpR O2O2 P P ArcB ArcA  P ArcA

80 NarX/L és NarP/Q - nitrát regulator - NarX és NarQ: membrán szenzor kináz - NarL és NarP: citoplazmatikus regulátor - szignál: nitrát és nitrit - nitrát metabolizmusra hat - NarL és NarP különböző génekre különböző atás  a génexpresszió finom hangolása NO 3 NarP  P NarX NarQ NarL  P P Kétkomponensű rendszerek vége

81 A lac operon kettős szabályozása  laktóz (allolaktóz) indukál  glükóz gátol, cAMP/CAP-n keresztül  glükóz/egyéb cukor kiiktatása tápból nem célszerű   glükóz szabályozás kikapcsolása

82 trp AATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCA tac AATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGA lacUV5 CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA lac CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGGTGTGTGGA “-35” “-10” lac (és trp) alapú promóterek lacUV5  lac promóter UV erősség

83 A transzkripciós faktorok sokoldalúak…. Ara C -Ara P BAD represszió +Ara P BAD indukció RNS polimeráz P BAD AraC P BAD

84 a) hurok képződés indul b) hurok képződés indul hibrid destabilizálódik c) termináció a) Rho kötődik és üldözi a polimerázt b) hurok képződés, polimeráz megáll c) Rho helikáz felszabadítja a transzkriptet, termináció Transzkripció termináció baktériumokban Rho függetlenRho függő

85 A transzkripció és a transzláció párhuzamosan megy baktériumokban

86 protein antranilát szintáz indol-glicerin szintáz triptofán szintáz A triptofán operon szerkezete

87 A triptofán operon szabályozása

88 Attenuáció-termináció – trp operon

89 E. coli-ban fehérje túltermeltetésre használt promóterek

90 mRNS degradáció baktériumokban mRNS stabilitás prokariótákban néhány perc, eukariótákban órás nagyságrend előbb utóbb minden RNS lebomlik mRNS stabilitását meghatározó faktorok: - belső, saját szerkezet - a környezet hatására bekövetkezett változás a degradációs apparátusban puf operon (a fotoszintetikus komplex komponensei) Rhodobacter capsulatus degradációja O 2 hatására felgyorsul policisztronos rendszerek esetén az alegységek arányának szabályozása a mRNS régióinak eltérő stabilitásával

91 A R. capsulatus puf mRNS régióinak stabilitása

92 - transzkripció gátlása (pl. rifampicin)t=0 időpontban, majd  időközönként mintavétel és RNS analízis (Northern..) -a degradációs mechanizmusban szerepet játszó gének deléciója, hőmérséklet érzékeny expressziós változatának kialakítása - in vitro transzkripció jelölt nukleotidokkal, a kapott termék inkubációja a sejtextraktummal különböző ideig, majd analízis gélelektroforézissel, kvantitálás mRNS degradáció baktériumokban, vizsgálati módszerek

93 mRNS-t stabilizáló-destabilizáló tényezők

94 Az 5’ végi struktúra stabilizáló hatása  a stabillizálódás a mRNS hurok struktúrájában van  nem csak a riboszóma véd,  a stabilizáló effektus átvihető más génekre

95 mRNS-eket stabilizáló (védő) tényezők 1.5’ végi trifoszfát 2.RNS struktúra 3.riboszóma

96 A degradoszóma felépítése

97 Az RNaseE elsődleges felépítése Érdekes módon sok bakteriális genomban nincs meg

98 A degradoszóma komponensei I. Endoribonuclease E (RNáz E)  1061 aminosav  118 kDa fehérje, virtuálisan 180 kDa (oka prolin gazdag régió)  felismerő hely: (A/G)AUU(A/T) vagy egy komplex másodlagos struktúra  5' monofoszfátot preferál  5' trifoszfát stabilizál N-terminális régió (50 kDa): endoribonukleáz funkció C-terminális: a degradoszóma egyéb komponenseire megfelelő kötő domének

99 A degradoszóma komponensei II. PNPase (polynucleotide phosphorylase)  78 kDa alegységek, homotrimer  3'  5' foszfát függő processzív exonukleáz,  ribonukleotid difoszfátok képződnek  poliadenilációs aktivitás Polyphosphate Kinase (PPK)  funkció: ATP regeneráció, polifoszfát (inhibiálja a degradációt) eltávolítás  ppk mínusz törzs : megnövekedett mRNS stabilitás  80 kDa alegységek, homotetramer, sok van E. coli-ban

100 A degradoszóma komponensei III. Helikáz  ATP függő DEAD (Asp-Glu-Ala-Asp) helikáz  50 kDa RhlB  a másodlagos struktúrák kinyitása szétroncsolása ATP hiányában a hurokstruktúra stabil marad

101 Egyéb – mRNS degradációjában résztvevő – enzimek RNáz II  70 kDa monomer,  a sejt 3'  5' exoribonukláz aktivitásának 90%-a  ribonukleotid monofoszfátok képződnek  a PNPáz-zal együttes deléciója letális !!! PolyA polimerázok PAPI 53 kDa PAPII 35 kDa  poliadeniláció, bázis hosszú  mRNS instabilitás

102 A mRNS degradáció mechanizmusa

103 Transzláció prokariótákban

104 A transzláció hatékonyságát meghatározó elemek 30S30S * 30S * + mRNAPK k1k1 k -1 PK k2k2 k -2 IK TK k3k3 ( 30S + IF1, IF2, IF3, fMet-tRNS Met ) ( preiniciációs komplex) ( iniciációs komplex) ( transzlációs komplex) K 1 nagy, ha az SD és a rRNS közti kölcsönhatás erős. k 2 a SD és a transzlációs start kodon közti távolság, és a régió másodlagos szerkezetének függvénye.

105 Shine - Dalgarno szekvencia GGAGG a tökéletes komplementer a 16S rRNS 3'végéhez, pl. GAAG GGAG mutáció (maltóz operon) 10 x növekedés a termék mennyiségében a SD szekvencia hosszának növelése nem feltétlenül növeli a transzlációt Hasonlóan a promóterekhez, túl erős kötődés a SD szekvencia és a 16S rRNS 3’ vége között a transzlációt gátolhatja. Transzlációs start kodon kodon gyakoriság AUG91 % GUG8 % UUG1 %

106 Az AUG előtti szekvenciák 20x-os különbség UAU, CUU >> UUC, UCA, AGG ("-1 triplet) G-k kerülendők Az AUG utáni szekvenciák 30x -oskülönbségek lehetnek AAA(Lys) > AAG(Lys) > UUU(Phe), AUC/A(Val), GUA(Ala)... A természetes gének között is az AAA(Lys) és GCU(Ala) transzlációs szabályozás a 2. kodonnal +10 régió AT gazdag

107 Távolság a start kodon és a SD között - meglehetősen érzékeny, általban bázispár megengedett. - Génfüggő, egy gén esetén általában csak kicsit változhat. A köztes szekvencia összetétele “A” jó, ha van (2x-es stimulus),“C” mindegy “U” a "-4"-es pozícióban hatékony “G” gátol (3x-os gátlás) Upstream nemtranszlálódó szekvencia Nem nagyon vizsgált, de kell, mert eltávolítása megszünteti a transzlációt (ld lac). Minimum 10 bp kell. Esetleg valamilyen faktorok kötődnek hozzá.

108 Kodon felhasználási preferencia Bár a kodonok gyakorlatilag univerzálisak, a különböző sejtféleségek különböző gyakorisággal használják az azonos aminosavakat kódoló tripleteket. Ha a termeltetendő fehérje génjének kodon használata nagyon eltér a gazdasejtétől, akkor meg kell szintetizáltatni a gént a gazda sejt preferenciájának megfelelően. Alternatív megoldás: a gazdasejt kodon preferenciájának megváltoztatása, ritka kodonokhoz tartozó tRNS gének bevitelével

109 [gbbct]: 50 CDS's (13879 codons) Sphingomonas paucimobilis AmAcid Codon Number /1000 Fraction Gly GGG Gly GGA Gly GGT Gly GGC Glu GAG Glu GAA Asp GAT Asp GAC Val GTG Val GTA Val GTT Val GTC Ala GCG Ala GCA Ala GCT Ala GCC Arg AGG Arg AGA Ser AGT Ser AGC Lys AAG Lys AAA Asn AAT Asn AAC Met ATG Ile ATA Ile ATT Ile ATC Thr ACG Thr ACA Thr ACT Thr A CC Trp TGG End TGA Cys TGT Cys TGC End TAG End TAA Tyr TAT Tyr TAC Leu TTG Leu TTA Phe TTT Phe TTC Ser TCG Kodon felhasználási preferencia – táblázat egy adott gén esetén a kodon preferencia alapján a gén E. coli-ban, vagy élesztőben való expresszálhatósága in silico becsülhető.

110 A transzláció terminációja STOP kodon UAA UGA UAG kötődő faktor RF1, RF2 RF1 RF2 UAA >> UGA, UAG Az esetek 80 %-ában: UAAU

111 PROTEOLÍZIS Abnormális fehérjék proteolitikus lebontási mechanizmusa E. coli-ban Abnormális fehérjék, sejten belüli aggregátumok ATP függő endoproteázok polipeptidek < 1500 Da endoproteázok peptidek aminosavak oldékony mono-, di- és tripeptidázok

112 La (Lon) a fő ATP függő proteáz  87 kDa egységekből felépülő homotetramer,  ATP és Mg 2+ függő, az ATP-áz aktivitás nem a polipeptid kötés felbontásához, hanem a degradálandó fehérjén való végiglovagláshoz kell,  in vitro 2 ATP/ peptidkötés, in vivo ez változhat, és ennél nagyobb.  hasonló fehérjék előfordulnak magasabbrendűekben is, pl. egy máj mitondriális proteáz immunológiailag keresztreaktív  abnormális fehérjék, és rövid élettartamú (pl. szabályozó fehérjék bontása)  szerin proteáz, hidrofób jellegű szekvenciáknál hasít  alapállapotban inaktív, a szubsztrát fehérje hozzákapcsolódása aktiválja,  a lon gén terméke, és a sokk fehérjékhez kapcsolódó szabályozás alatt áll:  32 faktor, ami a htpR (rpoH) gén terméke

113 inaktív proteáz (4 ADP) protein szubsztrát 4 ADP 4 ATP - Mg 2+ alloszterikus aktiválás aktív proteáz (4 ATP) 4 PO Mg 2+ A proteolitikus ciklus

114 Genetikai vonatkozások léteznek inszerciós, deléciós lon mutánsok A lon - mutáció másodlagos hatásai Poliszaharid burok képzés (főleg alacsonyabb hőmérsékleten, mint 34 o C) Megoldás: 37 o C-on növeszteni galE struktúrgének inaktiválása cps (capsule) struktúrgének inaktiválása rcsB, rcsA szabályozó régió mutánsok A lon mutánsok UV érzékenyek DNS sérülés  filamentáció Gazdag médiumon akár letális is lehet ok: SOS indukálható sejtosztódás inhibitor SulA. Megoldás: - ne használjunk yeast extraktot, hanem tryptont - sulA mutánsok

115 Ti (Clp) a másik ATP függő proteáz  81 (ClpA) és 21 kDa (ClpP) alegységekből álló heterodimer, ez multimerizálódik, a natív enzim kb 700 kDa móltömegű  ATP és Mg 2+ faktorok szükségesek hidrofób részeknél hasít, de a specificitás eltér a La-tól  az alegységek külön multimerizálódnak  HtpR szabályozás alatt áll TulajdonságTi (Clp) proteázClpPClpA aktivitásfehérje degradáció ATP hidrolízis mellett peptidáz ATP független ATP-áz fehérje aktivált KofaktorMg 2+ - InhibítorMalNEt, iPr 2 P-FiPr 2 P-FMalNEt StabilizálásATP, glicerinhőstabilATP, glicerin natív méret700 kDa260 kDa160 kDa alegységek6 ClpA + 12 ClpP21 kDa81 kDa

116 Genetikai vonatkozások  Rendelkezésre állnak clp mutánsok  a mutáns egyedül nem, de a lon- nal együtt hatékony Egyéb proteázok  OmpT külső membránhoz kapcsolódó proteáz  DegP periplazmatikus proteáz  T4 fág fertőzés stabilizálja a fehérjéket  pin gén terméke: La inhibitor

117 E. coli törzsgenotípusKiindulási törzsMegjegyzés lon mutánsok SG1117  gal  lac lon-146::  Tn10 leu sup+ rec+ HB101Tetraciklin rezisztens, jól transzformálható SG12041  gal,  lon-510 sulA recAC600nincs filamentáció Rec- lon htpR mutánsok SG21163  lon-510 supFts htpRam165MC4100hőmérséklet érzékeny lon clp mutánsok SG12044  gal  lon-510 sulA clpA319::  kan C600kanamycin rezisztens lon clp htpR mutánsok SG21173  lon-510 supFts htpRam165  clpA319::  kan  lac MC4100kanamycin rezisztens, hőmérséklet érzékeny Példák proteázaikban mutáns E. coli törzsekre

118 FÚZIÓS FEHÉRJÉK A fúziót gén szinten hozzuk létre úgy, hogy a fúziós partnerek génjeit a megfelelő leolvasási keretben úgy klónozzuk össze, hogy az 5’ vég felőli génhez tartozó transzlációs stop kodon ne szerepeljen. Így egy polipeptidláncot kapunk, amelyben a kiinduási fehérjék egymást követő régiókként helyezkednek el. ELŐNYEI 1. Kis peptidek esetén a fúzió proteolitikus stabilitást jelenthet 2.Óriási előny a tisztítás során, affinitás oszlopok 3.szignálpeptiddel való fúzió, szekretált fehérje (limitált) 4.Az in vitro hasítás sokszor pontosabb, intaktabb N-terminális szekvenciát eredményez

119 Oldhatatlan "iclusion bodies" trpEII, vagy cII, nincs proteolízis, differenciális centrifugálással az "inclusion body" könnyen tisztítható, probléma: nem aktív fehérje pl sometostatin, inzulin A, B, ellenanyag termelés Oldható forma biológiailag aktív fehérje, affinitás oszlopon való tisztítás problémák a stabilitással, kevésbé jósolható Fúziós fehérjék oldhatósága

120 Egyéb hasznosítási lehetőségek 1. a szignál peptidekkel való fúzió előnyei (ld. később) a periplazmában, illetve az extracelluláris térben oxidatívabb környezet, diszulfid hidak kialakulása, pl. EGF, IGF A periplazmában az összfehérje 4%-a található, értelemszerűen kevesebb proteáz,könnyebb tisztítás 2.A fúzionált fehérje linkerként szolgál, és így a kívánt fehérje immobilizálható 3.funkcionális, struktúrális vizsgálatok, pl. immunológiai felhasználás alkalmasan választott fúziós partner esetén nincs szükség hasításra.

121 A fúziós fehérjék tisztításának elve I. 1. affinitás kromatográfia II. hasítás III. 2. affinitás kromatográfia tiszta fehérje fúziós partner célfehérje

122 A fúziós fehérjék típusai I. I. Szekréció SX T P Megjegyzés pl. humán növekedési hormon alkalikus foszfatáz szignál szekvenciával II. Polimerizáció XX T P fehérje-élettartam növekedés, pl. proinzulin 1-2 percről 60 perc, IGF 200x-os növekedés III. C-terminális fúzió AX T P a fúziós partner intakt szabályozó régiója használható, pontosabb proteolitikus hasítás IV. N-terminális fúzió XB T P amino terminális szekvenciák meghatározása, a proteolititkus hasítás csonkot hagyhat a “B” N-terminálisán

123 A fúziós fehérjék típusai II. V. A szekréció és a C-terminális fúzió kombinációja AXS T P a termék folyamatosan kinyerhető affinitáskromatográfiával VI. Kettős fúzió AXB T P AXB T P XAB T P nagy tisztaságú, nagy stabilitású termék, hátrány: két tisztítás, hasítás szükséges VII. Szekréció-inszerció XIS T P membrán fehérjék termeltetése a membránban

124 FehérjeSzármazási helymolekulasúly (kDa)szekrécióligand  -galaktozidázEscherichia coli116-TPEG, APTG Protein AStaphylococcus aureus31+IgG Zszintetikus7+IgG CATEscherichia coli24+klóramfenikol sztreptavidinStreptomyces13+biotin PhoSEscherichia coli36+hidroxilapatit Protein GStreptococci28+albumin MBPEscherichia coli40+keményítô GSTEscherichia coli26-glutation poliargininszintetikus1-3-ioncsere poliglutamátszintetikus1-2-ioncsere polihisztidinszintetikus1-7+Ni 2+, Zn 2+, Cu 2+ Fúziós partnerfehérjék CAT: klóramfenikol-acetiltranszferáz; Z: A Protein A fehérje IgG kötô doménje; PhoS: foszfát kötô fehérje; MBP: maltóz-kötô fehérje; GST: glutation S-transzferáz; TPEG: p-aminofenil--d-tiogalaktozidáz; APTG: p-aminofenil--d-tiogalaktozid.

125 FÚZIÓS FEHÉRJÉK HASÍTÁSI MÓDOZATAI I. KÉMIAI hasító ágenshasítási hely brómcián- Met  hangyasav- Asp  Pro - hidroxilamin- Asn  Gly - ENZIMATIKUS aminopeptidázok aminosavat hasítanak az N-terminálisról karboxipeptidázok aminosavat hasítanak a C-terminálisról

126 FÚZIÓS FEHÉRJÉK HASÍTÁSI MÓDOZATAI II. Endopeptidázok ENZIMATIKUS ENZIMHASÍTÁSI HELY kollagenáz- Pro - Val  Gly - Pro - enterokináz- Asp - Asp - Asp - Lys  Xa faktor- Ile - Glu - Gly - Arg  trombin- Gly - Pro - Arg  tripszin- Arg, Lys  klosztripain- Arg  Ala 64 -szubtilizin- Gly - Ala - His - Arg 

127 Nómenklatúra: szekréció: az extracelluláris térbe export: az sejtmembránokba vagy a periplazmatikus térbe A fehérje szekréció Előnyei  A tisztítás sokkal egyszerűbb, esetleg folyamatos üzemű lehet  Az periplazma illetve az extracelluláris tér sokkal oxidatívabb, korrektebb protein folding  A fehérje degradáció sokkal csekélyebb mértékű, proteolitikusan stabilabb termékek

128 Baktériumok membránszerkezete

129 SZEKRÉCIÓ E. coli-ban  nem hatékony vagy nem teljes transzport a membránon keresztül  alacsony transzport-kapacitás, stresszválasz, idő előtti fehérjedegradáció  ha a transzporthoz a fehérje poszttranszlációs módosítása szükséges, akkor ennek hiánya kis molekulákra, mint növekedési faktorok vannak jó eredmények nagy molekulák esetén problémák lehetnek, pl az ER hiánya (módosítások színhelye) vannak fehérjék, amelyek nem szekretálhatóak, esetleg letális, pl -galaktozidáz fúziós fehérjék exportja

130 Fő protein transzport mechanizmusok baktériumokban Sec útvonal: egyszerű kofaktor mentes polipeptidekre Tat útvonal: több alegységes enzimekre, amelyek kofaktorokat is tartalmaz(hat)nak transzport: a fehérje összeszerelődése után SRP, signal recognition particle, és receptora E. coli homológ: Ffh forty five homolog, FtsY Poszttranszlációs transzport Kotranszlációs transzport

131 - szignál szekvencia, - szignál peptidázok, szignál peptidázI (lep), Ala-X-Ala felismerőhely - szignál peptidázII (lsp), szignál szekvenciák eltávolítása lipoproteinekrôl - sec A, B, D, E, Y gének mutációja a prekurzorok felhalmozódásához vezet, Némi átfedés van közöttük. -Régebben prl nómenklatúra is volt -SecA, 102 kDa, citoplazmatikus, és belső membránkötött, ATP-áz aktivitás, kölcsönhatás a szállítandó fehérjével -SecB szekréció kompetens konformációért felelős -SecYEFG a csatorna kialakításáért felelős -SecD a periplazmatikus térbe való “leválásért” Sec útvonal E. coli-ban

132 SZIGNÁL SZEKVENCIÁK GRAM - BAKTÉRIUMOKBAN I. Standard szignál peptid COOH “N”“H”“C”  1 K vagy R hidrofób  hélix, sok A és L, nem lehet P, K, R, D, E, H, R fordula t P G hasítóhely AGSAGS AXAX semleges vagy negatív fMfM G fordula t AVSAVS -3 Lipoprotein szignál peptid “C” COOH “N”“H”  1 K vagy R hidrofób  hélix, sok A és L, nem lehet P, K, R, D, E, H, R hasítóhely AGAG D lipoprotein kiválasztó szignál semleges vagy negatív fM L

133 Gram-pozítív baktériumok  a szignál peptid szignifikánsan hosszabb  kiterjedtebb “H” régió  a “H” régióban a Leu dominál  nem olyan szigorú a (-1, -3) szabály  a hasítóhely után nincs kitüntetett aminosav SZIGNÁL SZEKVENCIÁK II. Eukarióták az eukarióta szekretált fehérjéket az E. coli export mechanizmusa felismer(het)i, illetve fordítva

134 A Sec függő fehérje transzlokáció modellje E. coli-ban ATP ADP+P i SPáz YE G A B YE G A AT P ADP+P i YE G A D H+H+ H+H+ periplazma citoplazma INICIÁCIÓTRANSZLOKÁCIÓKISZABADULÁS N+N+ C+C+ CN citoplazma Átjutás a C-terminális véggel, ez az áltatános Átjutás az N-terminális véggel, inszerció

135 A Sec útvonal - másképpen

136

137 A prokarióta és eukarióta transzportmechanizmusok összehasonlítása

138 Az SRP (Ffh-FtsY) útvonal A Sec és az SRP közötti választás: “trigger” faktor membrán fehérjékre jellemző

139 Twin-arginine szignál peptid n-régióc-régióh-régió N + moderáltan hidrofób S/T-R-R-x-F-L-K n-regionc-region Sec szignál peptid h-region N erősen hidrofób + Signal sequences for targeting SRP: erősen hidrofób szignál, nem hasad le

140 A periplazmatikus hidrogenázok bioszintézise citoplazmatikus összeszerelődési modell Periplazma Citoplazma csatorna Holoenzim kofaktor(ok) prekurzor szignál peptid

141 citoplazma membrán periplazma N N N N C C C C TatA TatE TatB TatC The twin-arginine translocase (Tat) proteins A TAT modell I.

142 citoplazma TatC TatB TatA membrán aktív formát felvett enzim A TAT modell II.

143  Aktív formában termeltetni a fehérjét, ahogy in vivo előfordul, szekretáltatni, hogy a diszulfid hidak kialakuljanak  ha a fehérje mérgező a gazdasejtre, akkor először inaktív fehérjét állítunk elő, majd ezt aktiváljuk, ehhez kell az in vitro “refolding” Két fő stratégia: Az aktív forma esetén “csak” tisztítani kell a fehérjét Rekombináns fehérjék termeltetési stratégiái

144 Három fő lépés: 1. Az oldhatatlan “inclusion body”-t szolubilizáljuk, alacsony vagy magas pH, emelt hőmérséklet, detergensek, magas koncentrációjú szervetlen sók, vagy szerves oldószerek. A legelterjedtebbek: urea, vagy guanidin-hidroklorid, esetleg redukálószer (pl. DTT) jelenlétében. 2. Refolding híg fehérje oldattal - ha nincs diszulfid híd, akkor a fehérje denaturálószer lassú eltávolítása - ha diszulfid hidak vannak, akkor a renaturáció mellett a diszulfid hidakat is ki kell alakítani, szerkezet stabilizáló hatásuk van. levegőztetés, tiol-diszulfid párok hozzáadása, pH optimalizálása 3. Az aktív és inaktív forma szétválasztása pl. affinittás kromatográfia, preparatív natív PAGE, RP-HPLC, FPLC stb. REKOMBINÁNS FEHÉRJÉK AKTÍV FORMÁBA VITELE

145 T7 RNS polimeráz alapú vektorok - T7 promoter nagyon szelektív, a gazdában nincs ilyen promoter általában - T7 RNS polimeráz 5x gyorsabb, mint az E. coli-é, azaz már a transzkript is domináns Gazdasejtek: Standard klónozó vektorok klónozásra BL21 (F-, ompT-, lon-) expresszióra, lizogén sejtváltozatok: DE3 bakteriofág, immunitási régió, lacI gén, lacUV5 promoter lacZ eleje + T7 RNS polimeráz génje, integrálva kromoszómába Nagyon toxikus fehérjék esetén pLysS, pLysE T7 lizozim: természetes inhibitora a T7 RNS polimeráznak, E. coli tudja tolerálni, mert nem képes áthatolni a belső membránon pACYC184 vektorba van beépítve, cat r, kompatibilis vektor pLysE nagy mennyiséget, pLysS kevesebb mennyiséget termel (ellentétes orientáció, tet promoter CE6 bakteriofág tartalmazza a T7 RNS polimeráz génjét, így az indukció kívülről bejuttatott gén

146 kromoszóma lacI lacUV5 lac Z T7 RNS polimerázint vektor Prom.RBS  10 vagy T7/lac termeltetendõ fehérje génje OR I bla A pET vektorokon alapuló, indukálható fehérje termelés elvi sémája

147 A pET rendszer

148 pET vektorok  pBR322 származékok,  ampicillin, vagy kanamicin rezisztensek   10 promoter, a T7 fág  10-es génjének (kapszid) erős promótere T7 promoter van, de nincs transzlációs iniciációs szignál különféle verziók, stop szignálok bevitele vagy sem, fúziós partner esetleg a C terminálison Visszaszorulóban vannak 1. Transzkripciós vektorok Nagyon toxikus fehérjék esetén dupla biztosítás: a T7 promotertől startpont környékére a lac operátor szekvencia klónozása, elegendő lacI biztosítása, a vektorba beépítették ellentétes irányban T7lac promoteres változatok

149 Két transzkripciós vektor példa

150   10 transzkripciós és transzlációs szignálok,  mindegyik típusú egy sorozat különböző leolvasási keretekkel  Egy rövid fúzió az első 10 aminosavval (g10), de NdeI-gyel elkerülhető.  Esetenként  206aa fúzió  stabilitás Transzlációs vektorok

151

152

153 Szekréciós vektor Szabályozás Kontrollálhatóság Vektor felépítés Arabinóz alapú expressziós vektorok

154 Fehérje termeltetés in vitro In vitro transzláció Előnyei:  Oxidatív környezet  Citotoxicitás elkerülése, farmakológiai alkalmazások  Nincs membrán, a termék azonnal a reaktortérbe kerül  gyors Hátrányai:  Drága  Kitermelés korlátozott Két fő stratégia RNS polimerázzal +sejt extraktummal Tiszta komponensekből

155 Az in vitro fehérjetermeltetés folyamatábrája

156 T7 alapú rendszerek

157 Az igazán in vitro rendszer


Letölteni ppt "1 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció."

Hasonló előadás


Google Hirdetések