Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés.

Hasonló előadás


Az előadások a következő témára: "Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés."— Előadás másolata:

1 Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés B)regulon: gének szétszórva a genomban, közös regulátor operon regulon

2 A TRANSZKRIPCIÓS SZABÁLYOZÁS FŐBB GLOBÁLIS STRATÉGIÁI PROKARIÓTÁKBAN inaktív aktivátor inaktív aktív aktivátor indukálószer represszor inaktív represszor derepresszált KATABOLIKUS derepresszált aktív represszor indukálószer represszált BIOSZINTETIKUS KATABOLIKUS BIOSZINTETIKUS indukált aktív aktivátor inaktív aktivátor indukálószer RNS polimeráz inaktív represszor RNS polimeráz represszált negatív szabályozás pozitív szabályozás indukció represszió

3 A transzkripciós faktorok és aDNS közötti specifikus kölcsönhatás ún. Hélix-Turn-Hélix (HTH) motívumon megy keresztül csgD: NNEIARSLFISENTVKTH LY merR: IGEVALLCDINPVTLRAWQR HTH Motívumok: luxR: SWDISKILGCSERTVTFHLT lehet a faktor N vagy C terminálisán, a másik végen szokott lenni a ligand, kofaktor kötő régió

4 BAKTERIÁLIS TRANSZKRIPCIÓS FAKTOROK FŐBB CSALÁDJAI AraC családAraC, MelR, RhaS, RhaR, SoxS LysR családLysR, OxyR, MetR, CysB Crp családCrp, Fnr MerR családSoxR Két komponensűNarL, OmpR, Arc szabályozó család Lac represszor családLacI, GalR MetJ családMetJ Faktor család Tagok

5 Aktiváció a gén expresszióban I. Kölcsönhatás: -  CTD-nel (CRP) -  70 4-es régiójával ( cI aktivátor) -  NTD-nel (CRP) -  alegységgel (DnaA) -  ’ alegységgel (N4 single-stranded DNA kötő fehérje) -  CTD-nel és  70 4-es régiójával (FNR) Positive activation of gene expression Virgil A Rhodius, Stephen JW Busby Current Opinion in Microbiology 1998, 1:

6 Positive activation of gene expression Virgil A Rhodius, Stephen JW Busby Current Opinion in Microbiology 1998, 1: Aktiváció a gén expresszióban II. Promóter konformáció megváltoztatása: - “-35” és “-10” régió azonos oldalra kerül (MerR, SoxR) - DNS visszahajlik és az aktiváló cis szekvencia RNAP fölé kerül - DNS konformáció változást indukál (FIS, IHF)

7 DNS-hajlító fehérje (pl. IHF) Specifius kötőhely Távoli aktivátor helyek segítséget igényelnek

8 Aktiváció a gén expresszióban III. 2 aktivátortól függő promóterek: - az aktivátor kötődése egy másik aktivátortól függ (eukarióta) - aktivátor kötődése egy másik aktivátor áthelyeződését eredményezi (CRP-MalT a malK promóteren) - független aktiváció (  70 vagy  NTD és  CTD) - represszor müködését gátolja (FIS-NARL/P-FNR) Positive activation of gene expression Virgil A Rhodius, Stephen JW Busby Current Opinion in Microbiology 1998, 1:

9 Transzkripció repressziója baktériumokban

10 FNR - fumarát nitrát reduktáz regulátor - citoplazmatikus szenzor-regulátor - dimer[4Fe-4S] 2+  DNS-t köt - monomer[2Fe-2S] 2+  inaktív - aenaerob respirációra (+) vagy (-) hatás - pO 2 1 mbar alatt - TTGAT-N 4 -ATCAA konszenzus szekvencia - [2Fe-2S] 2+  [4Fe-4S] 2+ (in vitro) Cys, Fe, DTT, NifS - Pseudomonas: ANR; Bacillus: FNR Rhodobacter sphaeroides: FnrL O2O2 FNR red FNR ox

11 Komponensek - egy szenzor kináz és egy DNS kötő regulátor - E. coli genom 2% - kb 50 különböző 2 komponensű rendszer - 3 alcsalád: OmpR, FixJ és NtrC Két komponensű szabályozó rendszerek

12 P szenzor kináz fehérje DNS kötő fehérje P ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs ÉrzékelőFoszforilációs FelvevőDNS kötő FelvevőDNS kötő szignál transzfoszforiláció DNS A bakteriális kétkomponensű szabályozó rendszerek működése elve

13 - OmpR (E. coli): porin szerveződés szabályozása ozmózis változás hatására - általában  70 használó transzkripciót aktivál - kölcsönhatás az RNS polimeráz  alegységének C terminálisával - ha az N terminális foszforilálódik megszünik a gátló hatása a C terminális DNS kötő domén felé OmpR

14 - általában  70 használó transzkripciót aktivál - receiver domén deléciója esetén aktív transzkripció lesz FixJ NtrC - N terminális receiver és C terminális DNS kötő domén között egy központi ATPáz domén (glicin gazdag “Walker box”) - DNS kötő domén FIS-hez homológ (FIS: eukarióta enhancer kötő fehérje) - általában  54 használó transzkripciót aktivál

15 ArcA/B - aerobic respiratory control - ArcB (szenzor kináz): sejt redox és metabolikus helyzet (elektron transzport változást érzékel) - ArcA(citoplazmatikus regulátor): ArcB foszforilálja  aktív - pO mbar között - TATTTaa konszenzus szekvencia - Haemophilus: ArcA - E. coli homológ gén: OmpR O2O2 P P ArcB ArcA  P ArcA

16 ArcB oxigén mentes környezet FNR P Az ArcAB és FNR anaerob aktivációja

17 NarX/L és NarP/Q - nitrát regulator - NarX és NarQ: membrán szenzor kináz - NarL és NarP: citoplazmatikus regulátor - szignál: nitrát és nitrit - nitrát metabolizmusra hat - NarL és NarP különböző génekre különböző atás  a génexpresszió finom hangolása NO 3 NarP  P NarX NarQ NarL  P P Kétkomponensű rendszerek vége

18 A lac operon kettős szabályozása  laktóz (allolaktóz) indukál  glükóz gátol, cAMP/CAP-n keresztül  glükóz/egyéb cukor kiiktatása tápból nem célszerű   glükóz szabályozás kikapcsolása

19 trp AATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCA tac AATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGA lacUV5 CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA lac CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGGTGTGTGGA “-35” “-10” lac (és trp) alapú promóterek lacUV5  lac promóter UV erősség

20 A transzkripciós faktorok sokoldalúak…. Ara C -Ara P BAD represszió +Ara P BAD indukció RNS polimeráz P BAD AraC P BAD

21 a) hurok képződés indul b) hurok képződés indul hibrid destabilizálódik c) termináció a) Rho kötődik és üldözi a polimerázt b) hurok képződés, polimeráz megáll c) Rho helikáz felszabadítja a transzkriptet, termináció Transzkripció termináció baktériumokban Rho függetlenRho függő

22 A transzkripció és a transzláció párhuzamosan megy baktériumokban

23 protein antranilát szintáz indol-glicerin szintáz triptofán szintáz A triptofán operon szerkezete

24 A triptofán operon szabályozása

25 Termináció – attenuáció – trp operon

26 Termináció - antitermináció túl sokat nem lehet vele kezdeni, génen belüli sajátság

27 E. coli-ban fehérje túltermeltetésre használt promóterek

28 mRNS degradáció baktériumokban mRNS stabilitás prokariótákban néhány perc, eukariótákban órás nagyságrend előbb utóbb minden RNS lebomlik mRNS stabilitását meghatározó faktorok: - belső, saját szerkezet - a környezet hatására bekövetkezett változás a degradációs apparátusban puf operon (a fotoszintetikus komplex komponensei) Rhodobacter capsulatus degradációja O 2 hatására felgyorsul policisztronos rendszerek esetén az alegységek arányának szabályozása a mRNS régióinak eltérő stabilitásával

29 A R. capsulatus puf mRNS régióinak stabilitása

30 - transzkripció gátlása (pl. rifampicin)t=0 időpontban, majd  időközönként mintavétel és RNS analízis (Northern..) -a degradációs mechanizmusban szerepet játszó gének deléciója, hőmérséklet érzékeny expressziós változatának kialakítása - in vitro transzkripció jelölt nukleotidokkal, a kapott termék inkubációja a sejtextraktummal különböző ideig, majd analízis gélelektroforézissel, kvantitálás mRNS degradáció baktériumokban, vizsgálati módszerek

31 Bacterial exoribonucleases Polynucleotide phosphorylase Ribonuclease PH Ribonuclease II Ribonuclease R RNase D Ribonuclease T Ribonuclease BN Oligoribonuclease Bacterial endoribonucleases Ribonuclease I Ribonuclease III Ribonuclease P Ribonuclease E Ribonuclease HI A degradáció iránya virtuálisan 5'  3' irányú, de ilyen enzimaktivitást nem lehet kimutatni prokariótákban Megoldás: kombinált enzimműködés  degradoszóma RNázok, RNS degradáció

32 mRNS-t stabilizáló-destabilizáló tényezők

33 Az 5’ végi struktúra stabilizáló hatása  a stabillizálódás a mRNS hurok struktúrájában van  nem a riboszóma véd,  a stabilizáló effektus átvihető más génekre

34 mRNS-eket stabilizáló (védő) tényezők 1.5’ végi trifoszfát 2.RNS struktúra 3.riboszóma

35 A degradoszóma felépítése

36 Az RNaseE elsődleges felépítése Érdekes módon sok bakteriális genomban nincs meg

37 A degradoszóma komponensei I. Endoribonuclease E (RNáz E)  1061 aminosav  118 kDa fehérje, virtuálisan 180 kDa (oka prolin gazdag régió)  felismerő hely: (A/G)AUU(A/T) vagy egy komplex másodlagos struktúra  5' monofoszfátot preferál  5' trifoszfát stabilizál N-terminális régió (50 kDa) hasonlít a Caf-re (cytoplasmic axial filament protein)  feltételezett funkció a belső RNS transzportban N terminális 70 aa (S1 domén) hasonlít a PNPase és RnaseII (illetve (CSP, cold shock protein, RNS chaperon) RNS kötő doménjére C-terminális a degradoszóma egyéb komponenseire megfelelő kötő domének

38 A degradoszóma komponensei II. PNPase (polynucleotide phosphorylase)  78 kDa alegységek, homotrimer  3'  5' foszfát függő processzív exonukleáz,  ribonukleotid difoszfátok képződnek  poliadenilációs aktivitás Polyphosphate Kinase (PPK)  funkció: ATP regeneráció, polifoszfát (inhibiálja a degradációt) eltávolítás  ppk mínusz törzs : megnövekedett mRNS stabilitás  80 kDa alegységek, homotetramer, sok van E. coli-ban

39 A degradoszóma komponensei III. Helikáz  ATP függő DEAD (Asp-Glu-Ala-Asp) helikáz  50 kDa RhlB  a másodlagos struktúrák kinyitása szétroncsolása ATP hiányában a hurokstruktúra stabil marad

40 Egyéb – mRNS degradációjában résztvevő – enzimek RNáz II  70 kDa monomer,  a sejt 3'  5' exoribonukláz aktivitásának 90%-a  ribonukleotid monofoszfátok képződnek  a PNPáz-zal együttes deléciója letális !!! PolyA polimerázok PAPI 53 kDa PAPII 35 kDa  poliadeniláció, bázis hosszú  mRNS instabilitás

41 A mRNS degradáció mechanizmusa


Letölteni ppt "Gének koordinált regulációjának két fő mechanizmusa baktériumokban A)operon: gének egy lókuszban, közös transzkript, közös regulátor policisztronos elrendezés."

Hasonló előadás


Google Hirdetések