Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Génmanipuláció ecetmuslicában: P elem technikák A P elemek felfedezése, felépítése és mobilitásuk mechanizmusa.

Hasonló előadás


Az előadások a következő témára: "Génmanipuláció ecetmuslicában: P elem technikák A P elemek felfedezése, felépítése és mobilitásuk mechanizmusa."— Előadás másolata:

1 Génmanipuláció ecetmuslicában: P elem technikák A P elemek felfedezése, felépítése és mobilitásuk mechanizmusa

2 P elem függő hibrid diszgenezis Nőstény szülő Hím szülő M P M M P normális diszgenikus Csak M és P törzsek közötti keresztezés okoz hibrid diszgenezist, de csak akkor, ha a hím származik a P törzsből

3 P elemek populációs biológiai megoszlása a Drosophilidaek között  Nem mindegyik faj hordoz P elemeket  A D. melanogaster faj legközelebbi rokonaiban nem mutatható ki P elem  Távolabbi rokon fajok, D.willistoni és D.saltans hordoznak P elemeket  A D.willistoniban talált P elem csak egyetlen bp-ban különbözik a melanogasterben lévőtől.  Ez azt valószínűsíti, hogy a P elemek horizontális transzferrel kerültek át a D.willistoniból a D. melanogasterbe.  A horizontális transzfer mechanizmusa ismeretlen. Legalább 60 milliós evolúciós jelenlét ellenére miért csak mostanában terjedtek el a P elemek a D. Melanogasterben?  D. villistoni Közép- és Dél-Amerikából származik, és még ma is ott endemikus.  D. melanogaster ma egy kozmopolita faj, de Nyugat- Afrikából származik Feltételezik, hogy Amerikába az 1800-as évek elején jutott el.  A horizontális transzfer bármikor bekövetkezhetett azután, hogy a két elterjedési területe átfedett, azonban 1930-as évekig a P elemek még nem árasztották teljesen el a D. melanogaster populációkat A P elemek invázió-szerű elterjedése valószínűleg hatékony transzpozíciós mechanizmusuknak köszönhető.

4 ORF 0 ORF 1 ORF 2 ORF 3 IR CATGATGAAATAACATAAGGTGGTCCCGTCG CGACGGGACCACCTTATGTTATTTCATCATG 31 bp IR ATTAACCCTTA 11 bp IR TAAGGGTTAAT 11 bp IR Intron 1Intron 3Intron A vad típusú P elem felépítése

5 ORF 0 ORF 1 ORF 2 ORF 3 IR ATG TGA TAA AUG UAA AAAA AUG UGA AAAA AUG UAA AAAA belső deléció ivarsejt mRNS 87 kD transzpozáz szomatikus mRNS 66 kD represszor deléciós mRNS 24 kD represszor A P elem által kódolt mRNS-ek és fehérjék

6 DNS-kötődoménFoszforilációshelyekDimerizációsdomén GTP-kötő régió Katalitikus régió A P elem transzpozáz fehérje felépítése

7 A P elem transzpozáz  Helyspecifikus DNS-kötő endonukleáz, ami a polinukleotid-transzferázok családjába tartozik.  Mg 2+ és GTP kofaktorok szükségesek az aktivitásához.  Specifikus kötőhelye a P elemen végein található 31bp-os és 11 bp-os fordított ismétlődő szekvenciák között található (K D M).  Rendkívül magas a nem specifikus DNS-kötő képessége is (K D M).  Kötőhelye eltérő távolságra van a két végen található hasító helyektől.  Kötőhelye a P elem 5’-végén átfed a transzpozáz gén promóterében található TATA box-al, ezért az enzim transzkripciós represszorként is működhet.  Csak az 5’- és a 3’-végek egyidejű jelenlétében képes hatékony DNS hasításra.  Hasításának eredményeként 17 bp-os, 3’-túlnyúló ragadós végek képződnek. A 3’ hasítóhely pontosan a P elem végén, míg az 5’ hasítóhely a végtől 17 bp-ra van.

8 Transzpozáz kötőhelyek a P elemben IRBP 31bp IR 11bp IR Transzpozáz IRBP 31bp IR 11bp IR P elem promoter Transzpozáz mRNS GAAGTATACACTTAAATTCAG CTTCATATGTGAATTTAAGTC ACGTTAAGTGGATGTCTC TGCAATTCACCTACAGAG bp-ra az 5’ IR végtől 9 bp-ra a 3’ IR végtől AT A/C CACTTAA TA T/G GTGAATT konszenzus transzpozáz kötőhely

9 transzpozáz IRBP 8 bp-os inszerciós hely duplikáció 3’-vég5’-vég 31 bp-os IR szekvencia 21 bp-os spacer szekvencia 9 10 bp-os Transzpozáz kötőhely P elem A P elem transzpozoszóma felépítése  A DNS hasítás első lépésében a P elem végek szinapszist alkotnak.  Stabil nukleoprotein komplex jön létre.  A DNS hasítási és javítási reakciók ebben a komplexben játszódnak le.  A komplexet transzpozoszómának nevezzük.

10 NNNNNNNN CATGATGAAATAACATAAGGTGG GTACTACTTTATTGTATTCCACC NNNNNNNN CCACCTTATGTTATTTCATCATG GGTGGAATACAATAAAGTAGTAC Inszerciós hely duplikációja duplikációja P elem 5’ vég 3’ vég NNNNNNNN CATGATGAAATAACATA ATACAATAAAGTAGTAC NNNNNNNN GTACTACTTTATTGTATTCCACC AGGTGG CCACCTTATGTTATTTCATCATG GGTGGA P elem A P elem kivágódás mechanizmusa

11 A kettősszálú DNS törés javításának modelljei  A DSBR modell szerint szekvencia információ mindkét irányban folyik a templát és a célkromoszómák között.  P elem mobilizáció során a konverzió csak egyirányú: mindig a templátról a célkromoszómára történik.  A Synthesis Dependent Strand Annealing (SDSA) modell jobban leírja a Drosophilában lejátszódó eseményeket: - egyszálú DNS javítást feltételez - DNS szintézis un. buborék vándorlás szerűen játszódik le - nem alakul ki Holliday struktúra

12 Leánykromatida-függő javítás Homológ kromoszóma-függő javítás P elem Nem homológ végek összetapadása A P elem kivágódást követő DNS javítási útvonalak

13 GTACTACTTTATTGTATTCCACC AGGTGG CCACCTTATGTTATTTCATCATG GGTGGA P elem NNNNNNNN CATGATGAAATAACATAAGGTGG GTACTACTTTATTGTATTCCACC NNNNNNNN CCACCTTATGTTATTTCATCATG GGTGGAATACAATAAAGTAGTAC Inszerciós hely duplikációja duplikációja P elem NNNNNNNN GTACTACTTTATTGTATTCCACC AGGTGG CCACCTTATGTTATTTCATCATG GGTGGA P elem NNNNNNNN A P elem inszerció mechanizmusa

14 A P elem inszerciós preferenciái Az inszerciós hely szelekciójának pontos mechanizmusa nem ismert, azonban néhány szabályszerűség megfigyelhető:  Inszerciók nem random történnek, bizonyos szekvenciák preferáltak.  Inszerciók gyakrabban fordulnak elő eukromatinban, mint heterokromatinban.  Az eukromatinban un. inszerciós forró pontok találhatók.  Gyakran fordul elő inszerció másik P elemben, vagy annak közvetlen közelében.  Inszerciós gyakoriság nagyobb lokálisan, mint távolabbi régiókban.  Inszerciós gyakoriság nagyobb a nőstény csíravonalban, mint a hímivarsejtekben.  Génen belül inszerciósan preferáltak a nem kódoló 5’-végi szekvenciák.  Az inszerciós hely GC-ben gazdag


Letölteni ppt "Génmanipuláció ecetmuslicában: P elem technikák A P elemek felfedezése, felépítése és mobilitásuk mechanizmusa."

Hasonló előadás


Google Hirdetések