Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Molekuláris diagnosztika - Általános és orális patofiziológia szeminárium Dr. Varga Gábor Orálbiológiai Tanszék, Semmelweis Egyetem Budapest 2010.

Hasonló előadás


Az előadások a következő témára: "Molekuláris diagnosztika - Általános és orális patofiziológia szeminárium Dr. Varga Gábor Orálbiológiai Tanszék, Semmelweis Egyetem Budapest 2010."— Előadás másolata:

1 Molekuláris diagnosztika - Általános és orális patofiziológia szeminárium Dr. Varga Gábor Orálbiológiai Tanszék, Semmelweis Egyetem Budapest 2010

2

3

4 Példák a molekuláris diagnosztika eszközrendszerének alkalmazására Cysticus fibrosis Osteogenesis imperfecta Dentinogenesis imperfecta Amelogenesis imperfecta Hypohidrotikus ectodermalis dysplasia A szájüregi-nyaki régió daganatai Génterápia Human genom projekt

5 A genetika, a genomika és a génterápia orális/dentális alkalmazásának néhány kézenfekvő területe A fogfejlődés genetikai betegségei A fej-nyak régió rákos betegségei Caries képződés és fogerózió prevenciója Csontdefektusok korrekciója Krónikus fájdalom csökkentése Parodontális gyulladás kezelése Nyálmirigyek csökkent működésének gyógyítása Szisztémás betegségek kezelése nyálmirigyek génterápiájával

6 Az örökítőanyag Sejtjeink valamennyi életműködése az örökítőanyagukban tárolt program szerint játszódik le. Az örökítőanyag a sejtmagban lévő kromoszómákban található. A kromoszómák legfontosabb alkotórésze a DNS. sejt sejtmag kromoszóma

7 A szekvencia a DNS-molekulák replikációja során adódik tovább. A DNS-molekulák replikációja szemikonzervatív: az egyik szál változatlanul továbbadódva templátként szolgál az újonnan készülő szál szintéziséhez. A DNS replikációja

8 A gének A DNS-nek azt a szakaszát, amely egy adott tulajdonságunkat határozza meg, génnek nevezzük. DNS Kromoszóma egyik gén másik gén

9 Hogyan működik egy gén? A sejtmagban a génről a transzkripció során egy ún. RNS átirat készül. Ezt hírvivő RNS-nek nevezzük. A hírvivő RNS (mRNS) a sejtmagból kijutva a riboszómához kerül. A riboszómán készül el a transzláció folyamán az átirat alapján a fehérje. Az információ iránya tehát: DNS  RNS  fehérje SEJTMAGSEJTMAG maghártya DNS fehérje riboszóma gén hírvivő RNS mRNS fehérje

10 Az aminosavak genetikai kódja – bázishármas

11 Az aminosavak genetikai kódja

12 Molekuláris diagnosztikai módszerek Southern blot (polinukleotid hibridizáció) Northern blot (polinukleotid hibridizáció) Western blot (specifikus ellenanyagkötődés) Polimeráz láncreakció (PCR) ( gyakran reverz transzkripció után ) (oligonukleotid hibridizáció) DNA szekvenálás (nucleotid szintézis/lebontás követése specifikusan festődő nucleotidokkal) DNA array - DNA chip technológia (polinukleotid hibridizáció)

13 A reverz transzkripció Reverz transzkripcióhoz RNS-vírusokból (pl. M-MLV = Moloney egér leukémia vírus) izolált RNS-dependens DNS- polimerázokat, ún. reverz transzkriptázokat alkalmazunk. A reverz transzkriptázok ribonukleotid egységek egyszálú DNS-be épülését katalizálják templátfüggő módon. Templátjuk az RNS. A reverz transzkriptázoknak is szükségük van primerre. Lehetséges primerek: random hexamerek, oligo(dT) 12–18, génspecifikus anti-sense primer.

14 AZ “ÉGTÁJAK” Southern blot Northern blot Western blot – A DNS-t restrikciós enzimekkel emésztjük – A kapott fragmentumokat gélelektroforézissel méret szerint elválasztjuk – A gélt lúgban áztatjuk, hogy a DNS denatu- rálódjon, majd az egészet savval semlegesítjük – blottolás nitrocellulóz membránra – jelölés radioaktív DNS-sel – RNS blottolása, majd jelölés radioaktív DNS- vagy RNS-el – Fehérje blottolása, majd jelölés radioaktívan vagy enzimatikusan jelölt antitesttel

15 SOUTHERN BLOT

16 NORTHERN BLOT: AZ RNS RNS = ribonukleinsav a citoplazmában és a sejtmagban is megtalálható építőelemei: bázisok (A,G, C, U) ribóz foszfát csoport egyszálú, de ez nem jelenti azt, hogy egyenes is

17 TOTÁL RNS IZOLÁLÁSA TOTÁL RNS IZOLÁLÁSA – ultracenrifugálással (UC) Fehérje DNS CsCl RNS – Kit-ek segítségével pl. a fagyasztott szöveteket mozsárban folyékony nitrogén alatt porrá törjük. – fenol/kloroformos extrakcióval – kicsapás LiCl-dal vagy alkohollal Spektrofotometriás méréssel a 260 nm-en mért OD-ből az RNS oldat koncentrációja az alábbiak szerint számolható: Konc (µg/µl) = OD 260 x 40 RNS x oldási faktor 1000

18 GÉLELEKTROFORÉZIS Az RNS minták felvitele a zsebbe A foszfát csoportok miatt negatív töltéssel rendelkező RNS molekulák a negatív pólustól a pozitív pólus felé vándorolnak. formaldehidet tartalmazó denaturáló gél Negatív (-) elektród Pozitív (+) elektród puffer A vándorlás iránya futtató kád A nagyobb molekulák lassabban, míg a kisebbek gyorsabban vándorolnak a gél pórusai között és ezért távolabb kerülnek a kiindulási ponttól.

19 GÉLELEKTROFORÉZIS II Tehát az elválasztás a méret szerint történik. A B bázis-párosodott régió De előfordulhat, hogy úgynevezett hajtű formák jönnek létre. Ekkor viszont a molekulatömeg egyezése mellett is a méretek különbözőek lesznek. A B szerkezetű molekula gyorsabban fog haladni a gélben, mint az A. Ezt elkerülendő denaturáló körülményeket alkalmaznak, vagyis formaldehidet a gélben és a RNS felviteléhez alkalmazott úgynevezett mix oldatban.

20 KAPILLÁRIS BLOTTOLÁS Kád 20xSSC pufferrel3MM filter gél membrán A transzfer iránya száraz papírtörülközők 0.5 kg üveglap

21 HIBRIDIZÁCIÓ A hibridizálás során a komplementaritás elvét használjuk fel. Lényege: szekvencia- vagy alak-specifikus felismerés, mely két molekula egymáshoz kötődésekor jön létre –pl. egy DNS dupla-helix két szála kötődik egymáshoz, mert komplementerek Ugyanez az elv valósul meg egy szonda (próba) molekula és egy “cél “molekula között, melyek egy komplexet alkotnak. Ez a komplex lokalizálható, ha a szonda radioaktívan vagy enzimatikusan jelölve volt. A komplex lokalizációja pedig információval szolgálhat a “cél” molekuláról.

22 JELÖLÉS kétszálú templát DNS cukor- foszfát váz bázispárok denaturálás 5`, 95°C kettévált szálak hexamerek vagy oligo(dT) hozzáadása bázispárosodott hexamerek puffer nukleotidok 32 P-dCTP Klenow pl. új, radioaktív DNS jég, tisztítás radioaktív szonda Nick column Sephadex 50 denaturálás

23 HIBRIDIZÁCIÓ III UV-vel irreverzibilisen a membrán felületéhez kötjük az RNS-eket + = éjszakán át 42°C-on Egy sok komponensből álló hibridizáló oldatban a membránt előinkubáljuk, majd a szonda hozzáadása után hibridizáltatjuk 10 ml 20 ml 30 ml

24 WESTERN BLOT A fehérjék komplex molekulák, különbözhetnek méretben A fehérjék komplex molekulák, különbözhetnek méretben, töltésben, alakban (elsődleges, másodlagos, harmadlagos és negyedleges szerkezet), funkcióban és szekvenciában. Ami viszont mindegyikre igaz, hogy az aminosav szekvencia egyenes, nem alágazó. Érdekelhet bennünket egy fehérje olyan szempontból, hogy milyen gyógyszerhatással rendelkezik vagy megismerésével egy metabolikus folyamat jobban érthetőbbé válhat. Az eltérő célok eltérő fehérjetisztítási és eltérő fehérje kimutatási módok kidolgozását hívták életre. DNS  fehérje Fontos tudni a DNS transzkripció és mRNS transzláció folyamatát

25 WESTERN BLOT II Minta preparálás: Kisebb nagyobb eltérésekkel ugyanaz a módszer alkalmazható sejtekből és/vagy szövetekből történő izolálás esetén. Mindegyiknél fontos, hogy: * jégen legyenek a minták, * proteáz inhibítor koktélt alkalmazzunk, * tiszta, szennyeződésmentes eszközöket alkalmazzunk, * gyorsan kell dolgozni! Koncentrációmérés: * abszorpciós mérés 280 nm-en UV-ban (DNS tartalom bezavarhat) * Bradford kolorimetriás mérés nm-en specifikus, a funkcionális egységgel reagáló festék hozzáadását követően. Pl. Coomassie Brilliant Blue G-250 festék a bázikus és aromás aminosav részhez, pl. arginin-hez kötődik.

26 WESTERN BLOT III Natív elektroforézis: az elválasztás alapja a fehérjék eltérő töltése, mely jellemző egy adott pH-n. Sok lizin = erősen pozitív töltés, sok aszparaginsav rész = erősen negatív töltés Ennek megfelelően valamelyik a pozitív, valamelyik a negatív pólus felé fog vándorolni. Denaturáló PAGE = poli (30% acrilamid:bisakrilamid) gélelektroforézis minden fehérje rendelkezik hidrofób részekkel, ami képes detergens anyagokhoz kötődni, mint pl. a nátrium dodecyl szulfáthoz (SDS). Ezáltal válik minden fehérje negatívvá és ez egyenesen arányos a fehérje tömegével, tehát az elválasztást továbbiakban csak a méret fogja meghatározni.

27 WESTERN BLOT IV Kétféle pufferrendszert használnak: összefüggő: egyféle szeparáló gél van és ugyanaz a puffer a gélben és a tankban nem összefüggő: a szeparáló vagy “running” gél felett egy nem-korlátozó, nagy pórusú (~4%) “stacking” gél is található. (feszültség)*(töltés) (súrlódás a molekulán) A gélben a mobilitás=  1/molekulatömeg MERT: az SDS minden molekula körül a méretének (tömeg) megfelelő negatív töltést hoz létre, egy futtatás során az alkalmazott feszültség minden minta esetén azonos. Dithiothreitol (DTT) vagy 2-merkaptoetanol segítségével felbontjuk a cisztein részek közötti szulfidhidakat. SDS és DTT együttesen neutralizálja a fehérjék alakját.

28 WESTERN BLOT V Nagyon fontos kiválasztani az adott fehérje elválasztásához legmegfelelőbb %-os gélt. Stacking gél Running gél - +

29 WESTERN BLOT VI Kimutatás a futtatás után: festéssel (pl. Coomassie Brilliant Blue (R-250, G-250), Amido Black 10B, Serva Violet, and Fast Green FCF). Az eltérő festékek eltérő kimutathatósági határral rendelkeznek. Ezt követi minden esetben egy metanol:ecetsavban történő áztatás, ami a gélmátrixból eltünteti a festéket, és végeredményben csak a fehérjéhez kötött festékcsíkok fognak látszódni.

30 WESTERN BLOT VII Blottolás: célja, hogy a méret szerint elválasztott fehérjéket szilárd felületre, ált. nitrocellulóz vagy PVDF ( polyvinylidene difluoride ) membrán felületére vigyük át. Ez általában elektromos áram segítségével törté- nik, de a hagyományos kapilláris blottolással is megoldható. Blokkolás: BSA vagy zsírszegény tejporralBSA vagy zsírszegény tejporral

31 WESTERN BLOT VIII Detektálás: direkt: specifikus antitestekkel, mely az általunk érdekes fehérje epitóp ellen lett termeltetve. Az antitest vagy fluoreszcens festékhez (UV-ban deteltálható) vagy valamilyen enzimhez (tormaperoxidáz=HRP) van kötve. Ez utóbbi chemilumineszcens reakciót idéz elő, vagyis kémiai reakcióban fény keletkezik, ami azután röntgen filmen rögzíthető.

32 A polimeráz láncreakció (PCR) Mit tud? Mit tud? – A PCR arra alkalmas, hogy DNS-molekulák komplex elegyéből egy általunk kiválasztott tetszőleges DNS szakaszt specifikusan felsokszorozzunk. Mire jó ez nekünk? Mire jó ez nekünk? – Példák a PCR alkalmazási területeire:  leukémiákban, limfómákban kromoszóma-transzlokációk, kórokozók, monoklonalitás kimutatása  igazságügy (VNTR PCR: gyilkosság, nemi erőszak, apasági perek) Hogyan lehetséges ez? Hogyan lehetséges ez? – A PCR a DNS replikáció, ill. a DNS-polimerázok néhány sajátosságát használja ki.

33 puffer (10 mM TrisHCl pH 8,3–9,0; 50 mM KCl; 0,01% Triton X-100) templát DNS (kb. 0,5  g) primer (0,1–0,6  M) DNS-polimeráz (0,5–2,5 U / 50  l) Mg 2+ (1–5 (általában 1,5) mM) dNTP (50–500 (általában 200)  M egyenként) egyéb adalékok nukleázmentes körülmények PCR készülék (programozható termosztát) Ami egy PCR- hez kell PCR folyamatábra Animáció: denaturálás: 94–96 °C primerek kötődése: 50–65 °C DNS szintézis: 72 °C

34 A PCR-ben használt DNS-polimerázok Eleinte E. coli DNS-polimeráz I-et használtak PCR-hez, ám ez a templát denaturálására alkalmazott hőmérséklen inaktiválódik, ezért minden ciklusban új alikvotot kellett a reakcióelegyhez adni. Később termofil ősbaktériumok (Thermus aquaticus, - thermophilus, Pyrococcus furiosus, - woesei) hőstabil DNS-polimerázait kezdték alkalmazni. Hőstabil polimerázok tulajdonságai:

35 A PCR termociklus t t T I. I. Denaturáció (96 o C) dsDNS  ssDNS II. II. Annelálás (40-60 o C) a primerek a komplementer szekvenciákhoz kapcsolódnak III. III.polimerizáció (72 o C) DNS replikáció hőstabil DNS polimerázzal

36 SNP (egypontos nukleotid variáció, single nucleotide polymorphism) SNP (egypontos nukleotid variáció, single nucleotide polymorphism) 4,3 millió beküldött SNP 2,7 millió ref SNP (humán) 4,3 millió beküldött SNP 2,7 millió ref SNP (humán) május

37 Mutációk adatbázisa: Mutációk adatbázisa:

38 SNP-k és pontmutációk vizsgálata Alapelv: a különböző variánsok hossza nem különbözik, csak a bázissorrend tér el (egyetlen helyen) a szekvenciabeli eltérést hosszkülönbséggé kell alakítani Egyszálú konformációs polimorfizmus (SSCP) vizsgált (rövid) régió megsokszorozása PCR-rel denaturáló akrilamid gél-elektroforézis: ssDNS konformációja  mobilitása az egy bázis eltérés miatt kissé különböző

39 PCR- RFLP Restrikciós fragmentumok hosszúság(lenght) polimorfizmusa PCR- RFLP Restrikciós fragmentumok hosszúság(lenght) polimorfizmusa példa: DRD4 promoter –521CT SNP 1. vizsgált régió megsokszorozása: PCR –521CT 2. restrikciós emésztés: II. típusú restrikciós endonukleázok: 6–8 bp-os palindrom szekvenciát ismernek föl hasítási hely

40 DRD4 promoter –521CT SNP GTCCGGTCCC GGGACCCCCT GCCCAGGGTC AGAGGGGCGC CTACCTAGCT CACGGTCTTG GGCCGGAGGG AATGGAGGAG GGAGCGGGGT CGACCGCTCA GCTGTCCGCC CAGTTTCGGA GGCGGCCACG CGAGGATCAA CTGTGCAACG GGTGGGGCCG CGGCTGACCG TGGTGGTCGC GGGGGCTGAG GGCCAGAGGC TGCGGGGGGG GGGCGGCGGG ATGAGCTAGG CGTCGGCGGT TGAGTCGGGC GCGGAGTCGG GGGCAGGGGG AGCGGGCGTG GAGGGCGCGC ACGAGGTCGA GGCGAGTCCG CGGGGGAGGC GGGCAGAGCC TGAGCTCAGG TCTTTCTGCG TCTGGCGGAA CGGGCCTGGG AGGGAGGTTT TGCCAGATAC CAGGTGGACT AGGGTGAGCG CCCGAGGGCC GGGACGCACG CACGGGCCGG GTAGGATGGC GCTGGCGTCG ATGCCCGCGC GCTTCAGGGC CTGGTCTGGC CGCCCCTCCA TCCTTGTCGG TTTCTCGGGT CGCGGACCCC GCGCGGCGCC GGGCGATGCT GGCCTGCCCG TGGCCACCAC CTCGCTTCAT TCCCGTCTCT TTGGGCCGCC GCATTCGTCC ACGTGCCCGT CTCTCCCTGC GCAAAATTCC AAGATGAGCA AATACTGGGC TCACGGTGGA GCGCCGCGGG GGCCCCCCTG AGCCGGGGCG GGTCGGGGGC GGGACCAGGG TCCGGCCGGG GCGTGCCCGA GGGGAGGGAC TCCCCGGCTT GCGACCCGGC GTTGTCCGCG –521CT SNP

41 SNP-k vizsgálata: (RFLP) DRD4 promoter –521CT SNP GTCCGGTCCC GGGACCCCCT GCCCAGGGTC AGAGGGGCGC CTACCTAGCT CACGGTCTTG GGCCGGAGGG AATGGAGGAG GGAGCGGGGT CGACCGCTCA GCTGTCCGCC CAGTTTCGGA GGCGGCCACG CGAGGATCAA CTGTGCAACG GGTGGGGCCG CGGCTGACCG TGGTGGTCGC GGGGGCTGAG GGCCAGAGGC TGCGGGGGGG GGGCGGCGGG ATGAGCTAGG CGTCGGCGGT TGAGTCGGGC GCGGAGTCGG GGGCAGGGGG AGCGGGCGTG GAGGGCGCGC ACGAGGTCGA GGCGAGTCCG CGGGGGAGGC GGGCAGAGCC TGAGCTCAGG TCTTTCTGCG TCTGGCGGAA CGGGCCTGGG AGGGAGGTTT TGCCAGATAC CAGGTGGACT AGGGTGAGCG CCCGAGGGCC GGGACGCACG CACGGGCCGG GTAGGATGGC GCTGGCGTCG ATGCCCGCGC GCTTCAGGGC CTGGTCTGGC CGCCCCTCCA TCCTTGTCGG TTTCTCGGGT CGCGGACCCC GCGCGGCGCC GGGCGATGCT GGCCTGCCCG TGGCCACCAC CTCGCTTCAT TCCCGTCTCT TTGGGCCGCC GCATTCGTCC ACGTGCCCGT CTCTCCCTGC GCAAAATTCC AAGATGAGCA AATACTGGGC TCACGGTGGA GCGCCGCGGG GGCCCCCCTG AGCCGGGGCG GGTCGGGGGC GGGACCAGGG TCCGGCCGGG GCGTGCCCGA GGGGAGGGAC TCCCCGGCTT GCGACCCGGC GTTGTCCGCG –521CT SNP Fsp I

42 SNP-k vizsgálata: (Fsp I-RFLP) DRD4 promoter –521CT SNP –521CTnem polimorf 1. PCR 605 bp 560 bp 218 bp 342 bp TTCTCC –521T–521C TGTGCACGCGCA 2. RFLP Fsp I enzim 560 bp45 bp 342 bp218 bp

43 Az RT-PCR specifitása A PCR optimalizálásakor ugyanazokra a szempontokra kell figyelni, mint genomi DNS-ből kiinduló PCR esetén. További probléma: A sejtekből, szövetekből izolált RNS általában genomi DNS- sel szennyezett. Honnan tudjuk, hogy amennyiben megkaptunk egy génre jellemző PCR-terméket, az valóban az átíródó gén mRNS-éből kapott termék, vagy a genomi DNS- szennyeződést amplifikáltuk? Lehetséges megoldások: Tiszta RNS-t preparálunk (CsCl, ultracentrifuga). DNázzal emésztjük az RNS-mintáinkat. Olyan primereket tervezünk, melyek két különböző exonon helyezkednek el (így a genomi DNS-ből amplifikált termék hosszabb lesz).

44 1992-es adatok a DNS szekvenálásról: 1$/bp, 100,000 bp/év Humán genom 3x10 9 bp: 30,000 év, 3 milliárd dollár (?) Módszertani áttörések Automata DNS szekvenálás kifejlesztése Polimeráz láncreakció (PCR) Adatfeldolgozás fejlődése (Bioinformatika)

45 Az automata DNS szekvenálás elve ‘Színes szekvenálás` A di-deoxi lánctermináláson alapul... 3’ CAAGTCACCTTG CAAG AddA Termináló helyek Szekvenáló reakcióelegy: Mind a négy dNTP Mind a négy ddNTP különböző színű fluorogén festékkel DNA polimeráz, primer

46 + index Egy szekvenálási eredmény:

47 DNS chip technológia

48 A hibridizáció alapelve „Kihorgásszuk” a keresett génterméket, azaz RNS-t. Itt a „csalit” úgy hívják, hogy szonda (próba). Ez egy DNS- vagy RNS-darab, amely megegyezik a vizsgált gén egy szakaszával. A keresett RNS a „hal”, amire horgászunk. A hal megtalálja a csalit, azaz a próba és a keresett géntermék felismeri egymást komplementer bázisaik párosodása révén.

49 A próbák szabályos rendben helyezkednek el egymás után, mint a parton a horgászbotok. kukorica a pontynak kukac a keszegnek kishal a csukának

50 Az RNS-ek között mindenféle van.

51 Ha közülük valamelyiket egy próba fölismeri, az “horogra akad”. ponty keszeg csuka

52 Ha a halainkat megjelöljük, akkor láthatók lesznek. ponty keszeg csuka

53 Amelyik hal nem akadt horogra, az elúszik. ponty keszeg csuka

54 Amelyik hal nem akadt horogra, az elúszik. ponty keszeg csuka

55 A horgászbotok a valóságban A macroarray olyan nejlon membrán, amelyen meghatározott mintázatban felvitt cDNS klónok találhatók. A klónok azonosítása a filteren lévő pozíciójuk alapján lehetséges. egyik klón másik klón

56 Példa: Génexpressziós változások komplex vizsgálata Panc-1 adenokarcinóma sejteket 24 órán át inkubáltunk tápfolyadékban, ill. 100 nM forbol 12-mirisztát 13-acetát (PKC aktivátor) jelenlétében. A sejtekből teljes RNS-t izoláltunk, majd a kontroll, ill. a kezelt sejtek RNS-éről radioaktív reverz transzkripciós reakcióban jelölt komplex próbát szintetizáltunk. A jelölt próbákat két, egymással megegyező macroarray membránra hibridizáltuk. kontroll kezelt

57 RNA samples denature RNA RNA RNA sample sample 1 isolate RNA radioactive labeling labeled complex probe hybridize to macroarray with immobilized clones RNA sample sample 2 isolate RNA radioactive labeling labeled complex probe hybridize to macroarray with immobilized clones compare NorthernArray

58 cDNS-chip expressziós microarray készítés

59 cDNS-chip expressziós microarray: két-szín hibridizáció

60 cDNS-chip expressziós microarray: leolvasás: két-szín hibridizáció

61 Példák a molekuláris diagnosztika eszközrendszerének alkalmazására Cysticus fibrosis Osteogenesis imperfecta Dentinogenesis imperfecta Amelogenesis imperfecta Hypohidrotikus ectodermalis dysplasia A szájüregi-nyaki régió daganatai Génterápia Human genom projekt

62 A cysticus fibrosis kórtana Ionvezetési defektus Csökkent folyadékszintek Túlkoncentrált szekrétumok Obstruktív tubulopátia Pancreas: Exokrin hiány Endokrin hiány Pancreatitis Reproduktív: Ffi meddőség Bélrendszer: Meconium ileus Distalis béli elzáródás szindróma Máj: Epecirrhosis Epekövek Epesár Tüdő: Eltömődés Fertőzés Gyulladás Nyál- mirigyek csökkent működése

63 Epithelialis ion transzport - egészséges

64 Epithelialis sejt transzport - CF

65 Cysticus fibrosisos pancreas szövettani képe

66 A cysticus fibrosis gén azonosítása

67 A cysticus fibrosis transzmembrán konduktancia regulátor aminosav-szekvenciájának megismerésével következtethetünk rá, hogy a fehérje membráncsatornaként működik N-kapcsolt szénhidrátok Protein kináz C Protein kináz A Lizin, arginin és hisztidin Aszpartát és glutamin

68 Cysticus fibrosisban a pancreas leginkább a lumen koncentrációk defektusára érzékeny, melyet az acinarisan szekretált sok fehérje okoz és a ductalis cysticus fibrosis transzmembrán konduktancia regulátoron keresztüli anion (klorid, bikarbonát) és folyadék-szekréciótól függ. Gyors áramlás Alacsony fehérjetartalom Lassú áramlás Magas protein koncentráció Fehérje dugók Cysticus fibrosisban: Egészséges hasnyálmirigy: Ductus Acinus víz anionok

69 A cysticus fibrosis transzmembrán konduktancia regulátor génmutációi misszensz AA deléció nonszensz frame-shift splice defektus variáció teljes Membránt átérő ATP kötés R-domainMembránt átérő ATP kötés

70 Gén-mutációk típusai CF során NormálisNonszensz G542X frame-shift 394delTT splice junction 1717 – 1G—A Misszensz AA deléció ΔF508 Misszensz G551D Misszensz R117H Misszensz A455E Alternatív splicing kbC—T

71 A fogak röntgenfelvétele – a pulpakamra jól kivehető

72 A fogak morfogenezise

73 Osteogenesis imperfecta (OI) (a csont és a dentin betegsége) Az OI-t a COL1A1 gén (120150) vagy a COL1A2 gén (120160) mutációja okozza, vagyis a I. típusú kollagén két α láncai közül valamelyiknek a mutációja

74 Dentinogenesis imperfecta A dentin foszfoprotein (DPP), egy erősen savas fehérje, egyike a dentin legfontosabb nem-kollagén komponenseinek. Csak a fogak ectomesenchymális eredetű odontoblasztjai termelik. Takagi és Sasaki (1988) vetette fel először, hogy ennek a fehérjének a hiánya oki tényező a dentinogenesis imperfecta (DGI1; ) kialakulásában. MacDougall és mtsai (1997) mutatták ki, hogy a dentin 2 fő, nem-kollagén mátrix proteinjét, a dentin szialoproteint (DSP) és a dentin foszfoproteint (másnéven foszfoforint) egyetlen gén kódolja amelyet sialophosphoproteinnek (DSPP) is nevezünk

75 Amelogenesis imperfecta A zománc, a fogak legkülső felszínét borítja, s a test legkeményebb szövete, fehérjéi az enamelin (606585) és az amelogenin. Az amelogeninek nagymértékben konzervált fehérjék, szekréciójukat az ameloblastok végzik, a zománc szerves mátrixának 90%-át alkotják. Ezek a fehérjék lebomlanak és alkotórészeik felszívódnak, s ezzel párhuzamosan az ásványi kristályok jól strukturált prizma alakzatokba növekednek. Southern blot analízis segítségével, Lagerstrom és mtsai. (1991) kimutatták, hogy az amelogenin gén ( ) 5 kb-ig is terjedő deléciója férfiakban az amelogenesis imperfecta hipomineralizált formájához vezet. A hordozó nők heterozigóták. A defektus legalább 2 exonra kiterjed. A deléciós méret polimeráz láncreakciós (PCR) analízissel kimutatható

76 Génaktiválódás a fog fejlődése során (az Msx1 és Pax9 gének közvetlen szerepét az emberi foghiányok kialakulásában már igazolták)

77 Oligodontia hypohidrotikus ectodermális dysplasiában (HED) szenvedő betegben - az ectodysplasin gén mutációja

78 Az ectodysplasin gén módosítja a fogak megjelenését Normál egér Ectodysplasin -/- K.O. egér Ectodysplasin Overexpresszált egér

79 Clinical Genetics Volume 63 Issue 5 Page May 2003 Mini Review It's only teeth - are there limits to genetic testing? MJ Aldreda, PJM Crawford, R Savarirayan and J Savulescu Dental genetic disorders can cause severe social and psychological effects in affected individuals. The cost of treatment can be considerable, not only in financial terms but also in time spent during treatment. In theory it is, or will soon be, possible to use advances in molecular genetics for pre-natal testing, for selection of embryos using in vitro fertilization techniques, and for gene therapy. The questions we pose are whether these approaches are appropriate. We hope that this review will stimulate debate on these issues.

80 Genomika A genom: –Egy diploid sejt teljes haploid DNS tartalma +mitokondriális DNS A genomika: A genom működésének, szerkezetének, kölcsönhatásainak vizsgálata és az ezekhez tartozó módszerek. A nukleotidok vizsgálatán túl ide tartozik a fehérjék vizsgálata is, bioinformatika, „systems biology” stb. Genomika lehet pl.: Strukturális genomika Komparatív genomika Funkcionális genomika Humán genomika Farmakogenomika Orvosi genomika, stb.

81 A humán genom tulajdonságai (néhány kiragadott jellemző) 2003 április: a humán genom szekvenálása befejeződött Kb gént azonosítottak 1,2%-a az eukromatikus régiónak kódol fehérjét (exon) SNP-éket figyelembe véve két ember között átlagosan 1/1000 a különbség (99,9% egyforma) Átlagos exonszám: 12,2 exon/gén; Leggyakoribb intronméret: 87 bp; exonméret: 145 bp Legtöbb exon titin gén: 309 db

82 Mi az snip vagy SNP (Single Nucleotide Polymorphism)? ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT   snp snp Az SNP-k replikációs hiba vagy DNS károsodás révén jönnek létre. Ugyanahhoz a fajhoz tartozó két egyed között egyetlen bázis eltérése ugyanabban a DNS pozícióban, gyakoriság >1 %.

83 Polimorfizmus semleges??? Rizikó faktorok több mint 1%Frekvencia Kevesebb mint 1% Hatásbetegség Mutáció Egypontos nukleotid variációk/ SNP (“snips”) az ismert különbségek 90%-a a legtöbb SNP csak 2 allél változatban fordul elő Hosszúság polimorfizmusok STR (short tandem repeats) 2-6 bp álló szakaszok tandem módon egymás után ismétlődnek, az ismétlődések száma a személyek között nagy változatosságot mutat. VNTR (variable number of tandem repeats) Változó hosszúságú ismétlődő szekvencia részek Mutáció és polimorfizmus

84 Humán Genetikai Varibilitás CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC SNP szinten két ember átlagosan 0,1%-ban különbözik egymástól

85 Betegség iránt fogékony populáció Az összes egyed genotipizálása sok ezer SNP-re ATGATTATAG ATGTTTATAG Az összes rezisztens személynek A van az X gén 4-es pozíciójában, míg minden fogékonynak T van ugyanabban a pozícióban génX Rezisztens populáció

86 Örökletes betegség vagy öröklött állapot Térképezés Klónozott gén Diagnosztika A betegség biológiai alapjainak megértése Preventív medicina Farmako- genomika Génterápia Gyógyszeres terápia Idő Humán Genom Projekt révén felgyorsult

87 A genetika, a genomika és a génterápia orális/dentális alkalmazásának néhány kézenfekvő területe A fogfejlődés genetikai betegségei A fej-nyak régió rákos betegségei Caries képződés és fogerózió prevenciója Csontdefektusok korrekciója Krónikus fájdalom csökkentése Parodontális gyulladás kezelése (emberi és bakteriális genomika) Nyálmirigyek csökkent működésének gyógyítása Szisztémás és szájüregi betegségek kezelése nyálmirigyek génterápiájával


Letölteni ppt "Molekuláris diagnosztika - Általános és orális patofiziológia szeminárium Dr. Varga Gábor Orálbiológiai Tanszék, Semmelweis Egyetem Budapest 2010."

Hasonló előadás


Google Hirdetések