Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Posztmodern genetika: systems biology, avagy reményen innen, kétségeken túl FALUS András Semmelweis Egyetem Genetikai.

Hasonló előadás


Az előadások a következő témára: "Posztmodern genetika: systems biology, avagy reményen innen, kétségeken túl FALUS András Semmelweis Egyetem Genetikai."— Előadás másolata:

1 Posztmodern genetika: systems biology, avagy reményen innen, kétségeken túl FALUS András Semmelweis Egyetem Genetikai Sejt- és Immunbiológiai Intézet

2

3 A genetika-genomika mérföldkövei 1866 Mendel – az öröklődés szabályainak felismerése 1869 Miescher – a DNS felismerése 1902 Sir Archibald Garrod – az első human betegség genetikai okora való visszavezetése 1905 William Bateson- a genetika szó bevezetése 1944 McLeod –MacCarty – a DNS az örökítő anyag 1953 Watson - Crick kettős hélix 1977 DNS sequenálás 1977 K. Mullis PCR 1988 Andreson mtDNS 1990 HUGO 1991 Pat Brown - DNS microarray 1996 Ian Wilmut - Dolly 2001 A postgenomikus éra kezdete microRNS-pyknonok Két genom kópia 23 kromoszóma ~ gén (1.3% kódoló) 3.2 milliárd nukleotid 2 m/sejt ! (teljes szervezetben 4.6 fénynapnyi DNS)

4

5 Mi a genomika ? A teljes genom DNS szintű variációinak és az expressziós mintázatok (mRNS, miRNS) összességének bioinformatikailag értékelt összhangzattana

6 GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Egyedi SNP-től az SNP haplotípusig= SNP sorozat (SNP mintázat)

7  emberi faj közös gén szekvencia mintázatai  emberi rasszok genom analízse  publikus, ingyenes hozzáférés biztosítása  eszközrendszer biztosítása a nagy populációkat érintő komplex betegségek genom szintű kezelésére 20 M SNP/genom

8 Farmakogenomikai stratégia From McLeod and Evans, Ann Rev of Pharmacol and Toxicol, 2001: 41, GCCCACCTCGCCCGCCTC

9

10 Cost < $ 1.000

11  biológiai nanotechnológia  „high-throughput” 256 K/cm2, 3 M SNP/nap, 1M nt/sec  automatizált  in silico értékelés prediktív potenciál személyreszabott medicina Pl.  Immungenomika  Onkogenomika  Farmakogenomika  Lipidomika  Receptoromika…..

12 ethnogenomics expressomics fluxomics foldomics fragmentomics fragonomics functional lectinomics functionomics functomics galectinomics genomics glycogenomics glycomics gpcromics hygienomics immunogenomics immunomics immunoproteomics inomics integromics ioncogenomics ionomics kinomics lectinomics ligandomics lipidomics lipoproteomics localizomics metabolicphenomics metabolomics metabonomics metallomics metaproteomics methylomics microbiomics mitogenomics morphomics neurogenomics nobonomics nucleomics operomics orfeomics paleogenomics parasitomics pathogenomics pathomics peptidomics pharmacoepigenomics pharmacogenomics pharmacomicstabonomics pharmacomicsthylomics pharmacophylogenomics pharmanomics phenomics phosphatomics phosphoproteomics phylogenomics phylomics phyloproteomics physiogenomics physiomics physionomics postgenomic post-translatomics predictomics promoteromics proteogenomics pseudogenomics psychogenomics receptoromics regulomics resistomics resourceomics ribonomics riboproteomics ribosomics rnomics robogenomics saccharomics secretomics separomics signalomics somatonomics strainomics subproteomics syndromics systeomics targetomics toponomics toxicogenomics toxicomics toxigenomics transcriptomics transductomics transgenomics translatomics transportomics transportomics; trinomics unknomics vaccinomics velocegenomics viromics alleomics allergenomics behaviouromics bibliomics biomics bionomics cardiogenomics cellomics chemogenomics chemoproteomics chomics chromatinomics chromonomics chromosomics chronomics clinomics combinatorial peptidomics complexomics computational rnomics cryobionomics cryptomics crystallomics cytochromics cytomics degradomics diagnomics differential transcriptomics economics ecotoxicogenomics eicosanomics embryogenomics enviromics enzymomics epigenomics epitomics

13 tudásanyag *hagyomány *divat *„grant-climate” Hipotézis, prekoncepció Kisérlet, eredmények Génvadászat „prekoncepció-mentes” Kutatás-vezérelt tudomány Hipotézis-irányította tudomány genomikai megközelítés

14 Coeur How many base pairs?

15 Genomika a társadalomban A genomika és a biobankok orvosi és nem orvosi felhasználásnak szabályozása, nemzetközi (EU) jogharmonizáció Rasszok és az etnikumok közötti genomikai eltérések jellemzése, feltárása, következményei Az emberi tulajdonságok és viselkedés genomiális alapú jellemzése és következményeinek megértése A genomika etikai szabályainak megalkotása

16 Types of Networks Social networks -connections among people -trade among organizations, countries -citation networks -computer networks -telephone calls Organic molecules in chemistry Genes and proteins in biology Connections among words in text Transportation (airlines, streets, electric networks, etc)

17 Single disciplines chemistry economics biology sociology psychology anthropology Philosophy chemistry economics biology sociology psychology anthropology Philosophy Simple systems Complex systems

18 Networks in biology

19 Systems Biology: the concept 1. Investigates the behavior and relationships of all of the elements in a particular biological system while it is functioning 2. Highthroughput measurements are integrated, graphically displayed, and ultimately modeled computationally

20 genom-alapú biológia „systems biology”= rendszer-szemléletű biológia  genomikai adatbázisok  „high-throughput” technológiák  bioinformatika

21

22 NFkB Idő- és térorientált adatkezelő softverek = „gén-szomszédosság”

23 Teljes Genom Asszociáció *** ** Teljes genom screen - 100,000s SNP Kérdéses régió kiválasztása Genomikus info— gének, SNP-k Ífinom térképezés

24 Complement factor H polymorphism in age-related macular degeneration (AMD) Klein RJ et al, Science, 2005, April, 15;308: Age-related macular degeneration is a major cause of blindness in the elderly. A genome-wide screen of 96 cases and 50 controls for polymorphisms associated with AMD. Among 116,204 SNP genotyped. An intronic and common variant in the complement factor H gene (CFH) strongly associated with AMD. In individuals homozygous for the risk allele, the likelihood of AMD increased by a factor of 7.4. Resequencing revealed a polymorphism in linkage disequilibrium with the risk allele representing a tyrosine-histidine change at amino acid 402. This polymorphism in a region of CFH that binds heparin and C-reactive protein. The CFH gene is located on Chr 1 in a region repeatedly linked to AMD in family-based studies.

25 Septin2-like genes RAD50IL13IL4 IL5IRF1 OCTN2OCTN1RIL P4HA2 CSF2IL3 LACS2 SNPs = 50 kb CAh14bATTh14cIL4m2GAh18aCAh15a IRF1p1 CAh17aD5S1984CSF2p10 84 kb 3 kb14 kb 30 kb25 kb11 kb92 kb21 kb27 kb55 kb19 kb 94%96%92%94%93%97%93%91%92%90%98%  TATAG TATCA CGGCG GGACAACC AATTCGTG TTACG CCCAA CGGAGACGA GACTGGTCG CGCAGACGA CGCGCCCGGAT TTGCCCCGGCT CTGCTATAACC CTGCCCCAACC CCAGC CAACC GCGCT CCACC CCGAT CTGAC ATACT CCCTGCTTACGGTGCAGTGGCACGTATT*CA CATCACTCCCCAGACTGTGATGTTAGTATCT TCCCATCCATCATGGTCGAATGCGTACATTA CCCCGCTTACGGTGCAGTGGCACGTATATCA CGTTTAG TAATTGG TGTT*GA TGATTAG ACAACA GTGACG GCGGTG ACGGTG GTTCTGA TGTGCGG TG*GTAA Crohn disease- chromosome 5.

26 Obesitás Stroke ApoE HDL Diéta ApoB Triglycerid LDL partikulum méret Vérnyomás Mozgás ACE Insulin Alvadási factorok 280 rizikó tényező Dohányzás LDL Cholesterol

27 Sejtek Génhálózatok? gén A gén B gén C gén D Expresszió microarray Génhálózat modell A B E C D Génexpressziós adatok és a génhálózatok „reverz” modellezése microarray adatokból

28 Challenge for the mouse? Challenge for the scientist? „knock-in” és „knock-out” modellek: többszörös ko kondicionált ko gene-silencing MODELLEK?

29 ppm Integrativ Genomika: Systems Biology Targetek és Biomarkerek Targetek és Biomarkerek Integrative Genomics Integrative Genomics Emberi és állati modellek: szövetek vérsejtek plasma vizelet CSF Gének Fehérjék Metabolitok Proteome analytics metabollome analytics genome analytics

30 Database analysis – peptide binding prediction? CTRPNNTRK CTRPNNTRK ? “data warehouse” Intelligent vaccines microbial databank MHC databank

31 Changing the Paradigm of Discovery /immunology/ Research through Systems Biology

32 BIBLIOMICS ??? Text mining

33 UCSD CYTOSCAPE PLATFORM

34 Example IUIS Allergen repository PubMed abstracts Sequence databases Literature Allergen sequences Cross-reactivity data ALLERDB data warehouse TOOLS: Search, BLAST, 3D visualisation, allergenicity, allergic cross-reactivity MANUAL TEXT MINING Miotto O., Tan T.W., Brusic V. (2005). Extraction by example: induction of structural rules for the analysis of molecular sequence data from heterogeneous sources. Lecture Notes in Computer Science 3578, Miotto O, Tan TW, Brusic V. (2005). Supporting the curation of biological databases with reusable text mining. Genome Informatics 16(2),

35

36 „bibliomics” abstract (neuropsych+immune-inflammation) 39,000 bio-molecular kapcsolat: 5,400 gén Cytoscape – SCHIZOPHRENIA

37

38 * Minden génnél SNP LOD score és gén expresszió kombináció = Z-score. * Minden gén Z érték és a szomszédos Z értékek kapcsolása * a hálózat összes csomópontja, ami >Z küszöb

39 Hét gén

40 Minden potenciális csomópont gyógyszertarget molekula

41 Klinikai adatok Laboratóriumi adatok Genetikai/genomikai adatok Szakirodalom Biobankok Multicentrikus klinikai /genetikai/ kollaborációk sémája Új diagnosztika, Gyógyszerfejlesztés, terápia Bioinformatika, adatbázis kezelés, artificial intelligence Minimális betegszám: 1000 Minimális SNP: Költség?

42 A molekuláris biológia korszakának legnagyobb tévedése: a betegségek genetikai okát csak a génekben keresni Malcolm Simons, John Mattick—Nobel-dij jelöltek 2004, 2005 Genom: 98.7%-a nem kódoló („junk-DNA”- postGene rendszer) (csimpánz genom—0.1 % eltérés kódolóban, >4% nem-kódolóban) Funkció: microRNA (hairpin-RNA, reguláció), ???? Példák: pajzsmirigy, protata cc, neurodevelopment, apoptosis….. Az egyik legnagyobb „BUMM” a genomika- „systems-biology” korában

43

44 Biological dimensions Genome genes Transcriptome mRNA/cell Proteome proteins/cell Metabolome ????? 1.3% of the genome 98.7% „junk”? postgenes? microRNA? intron transcripts? pyknons?

45 Micro RNA ~22nt rna Precursor stem& loop Post-transcription regulation –gene silencing and….????

46 microRNA expression profiles classify human cancers Lu et al. Nature 435: 834, 2005 RNA-ome

47 Copyright ©2006 by the National Academy of Sciences Pyknons-pyknome Short blocks from the noncoding parts of the human genome have instances within nearly all known Rigoutsos, Isidore et al. (2006) Proc. Natl. Acad. Sci. USA 103, pyknon patterns/mosaics/ in transcripts from human genes  A crucial link between non-coding and coding genome- A PYKNON-BASED REGULATORY LAYER  Influences almost all annotated genes  Phylogenetic conservatism

48 Copyright ©2006 by the National Academy of Sciences Rigoutsos, Isidore et al. (2006) Proc. Natl. Acad. Sci. USA 103, PNASPNAS Pyknons in the 3' UTRs of the apoptosis inhibitor birc4 and nine other genes >66 million motifs with multiplicities well above what is expected by chance 127,998 patterns, termed pyknons, nonoverlapping instances in the untranslated and protein-coding regions of 30,675 transcripts from 20,059 human genes

49

50 FractoSet-ek hierarchikus felépülése szekvencia- eltérésekkel és fraktál- szekvencián belüli és közötti pyknon-szekvenciákkal A pyknonok is meghatározott sorrendben, nagyobb egységekben rendeződnek?

51

52

53 Dept. of Genetics, Cell- and Immunobiology, Semmelweis University, Budapest, Hungary Köszönet: GSI Intézet, munkatársaim Dr. Molnár Mária Judit (OPNI)

54

55

56

57

58


Letölteni ppt "Posztmodern genetika: systems biology, avagy reményen innen, kétségeken túl FALUS András Semmelweis Egyetem Genetikai."

Hasonló előadás


Google Hirdetések