Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Bioinformatika gyakorlat (biomérnök hallgatóknak) Adatbázisok Szekvencia illesztés Hasonlóság keresés Filogenetikai programok PCR primer tervezés Promóter.

Hasonló előadás


Az előadások a következő témára: "Bioinformatika gyakorlat (biomérnök hallgatóknak) Adatbázisok Szekvencia illesztés Hasonlóság keresés Filogenetikai programok PCR primer tervezés Promóter."— Előadás másolata:

1 Bioinformatika gyakorlat (biomérnök hallgatóknak) Adatbázisok Szekvencia illesztés Hasonlóság keresés Filogenetikai programok PCR primer tervezés Promóter predikció (génpredikció)

2 Kiindulási „anyag” a szekvencia Molekuláris biológiában, taxonómiában/filogenetikában használt „objektum” a szekvencia DNS nukleotidsorrend Fehérje aminosav-sorrend Milyen információt hordoz Gén/géntermék A szekvencia „hasonlóságban” rejlő információ Leszármazás/eredet/változásFunkcionálisSzerkezeti

3 Egyéni (csoportos) feladat beadása elektronikus formában

4 Szekvencia manipuláció Adatbázisok Szekvencia letöltés/manipuláció Hasonlóság kimutatása – számítógép szerepe > sm nt sequence GGGCGAGCGATAGTGCTAACTCAAAAAATCCTATGAGGACGAACCATGGCCAAGCGAAAGGCGCGCATCGACAGCGCCGC CGAAGCCGTGCGCGTCATGGCGAAGGCAACCCCCGAGATTGAGCCGCCGGCAAACGTGCCGCTCGACGAAGAAGACCTG CCGTTCTTCCGCAACGTGATCGCTGAGTACGCGCGGTCGGAATGGTCGTCGCATCAACTCGAGCTCGCCGCAATGCTGGCC CGCACCATGGCGGACCTGACGCGCGAGCAGAAACTGCTGCGAGACGAAGGCGGTGTTGCCTACTCCGAAAAAGGCACAC CTGTCGCGAATCCGCGCAAGTCGATTGTGCAAATGCACGCCAGTTCGATCCTGTCCTTTCGTCGATCATTGTCGCTTCACGC ACGCGCGCAAGCGGGCGAGGCGAGGGACGTTGCGAAGCGCC > sm nt sequence GGGCGAGCGATAGTGCTAACTCAAAAAATCCTATGAGGACGAACCATGGCCAAGCGAAAGGCGCGCATCGACAGCGCCGC CGAAGCCGTGCGCGTCATGGCGAAGGCAACCCCCGAGATTGAGCCGCCGGCAAACGTGCCGCTCGACGAAGAAGACCTG CCGTTCTTCCGCAACGTGATCGCTGAGTACGCGCGGTCGGAATGGTCGTCGCATCAACTCGAGCTCGCCGCAATGCTGGCC CGCACCATGGCGGACCTGACGCGCGAGCAGAAACTGCTGCGAGACGAAGGCGGTGTTGCCTACTCCGAAAAAGGCACAC CTGTCGCGAATCCGCGCAAGTCGATTGTGCAAATGCACGCCAGTTCGATCCTGTCCTTTCGTCGATCATTGTCGCTTCACGC ACGCGCGCAAGCGGGCGAGGCGAGGGACGTTGCGAAGCGCC

5 > sm nt sequence CGAACCATGGCCAAGCGAAAGGCGCGCATCGACAGCGCCGCCGAAGCCG TGCGCGTCATGGCGAAGGCAACCCCCGAGATTGAGCCGCCGGCAAACGTG CCGCTCGACGAAGAAGACCTGCCGTTCTTCCGCAACGTGATCGCTGAGTA CGCGCGGTCGGAATGGTCGTCGCATCAACTCGAGCTCGCCGCAATGCTGG CCCGCACCATGGCGGACCTGACGCGCGAGCAGAAACTGCTGCGAGACGA AGGCGGTGTTGCCTACTCCGAAAAAGGCACACCTGTCGCGAATCCGCGCA AGTCGATTGTGCAAATGCACGCCAGTTCGATCCTGTCCTTTCGTCGATCATT GTCGCTTCACGCACGCGCGCAAGCGGGCGAGGCGAGGGACGTTGCGAAG CGCC > sm nt sequence GGGCGAGCGATAGTGCTAACTCAAAAAATCCTATGAGGACGAACCATGGC CAAGCGAAAGGCGCGCATCGACAGCGCCGCCGAAGCCGTGCGCGTCATG GCGAAGGCAACCCCCGAGATTGAGCCGCCGGCAAACGTGCCGCTCGACG AAGAAGACCTGCCGTTCTTCCGCAACGTGATCGCTGAGTACGCGCGGTCG GAATGGTCGTCGCATCAACTCGAGCTCGCCGCAATGCTGGCCCGCACCAT GGCGGACCTGACGCGCGAGCAGAAACTGCTGCGAGACGAAGGCGGTGTT GCCTACTCCGAAAAAGGCACACCTGTCGCGAATCCGCGCAAGTCGATTGT GCAAATGCACGCCAGTTCGATCCTGTCCTTTCGTCGATCATTGTCGCTTCAC GCACGCGCGCAAGCGGGCGAGGCGAGGGACGTTGCGAAGCGCCGGGCG AGCGATAGTGCTAACTCAAAAAATCCTATGAGGA

6 CGAACCATGGCCAAGCGAAAG CGAACCATGGCCAAGCGAAAG ||||||||||||||||||||| ||||||||||||||||||||| GGGCGAGCGATAGTGCTAACTCAAAAAATCCTATGAGGACGAACCATGGCCA AGCGAAAG GCGCGCATCGACAGCGCCGCCGAAGCCGTGCGCGTCATG |||||||||||||||||||||||||||||||||||||||.... GCGCGCATCGACAGCGCCGCCGAAGCCGTGCGCGTCATG GGGACGTTGCGAAGCGCC GGGACGTTGCGAAGCGCC |||||||||||||||||| GGGACGTTGCGAAGCGCCGGGCGAGCGATAGTGCTAACTCAAAAAATCCTAT GAGGA GGGACGTTGCGAAGCGCCGGGCGAGCGATAGTGCTAACTCAAAAAATCCTAT GAGGA Illesztett szekvencia GGGCGAGCGATAGTGCTAACTCAAAAAATCCTAT GAGGA |||||||||||||||||||||||||||||||||||||||

7 Adatbázisok NCBI, EBI, GenomeNet PubMed Elsődleges (nukleotid) Származtatott (aminosav szekvencia, egyéb jellemzők

8 Illesztési módszerek a hasonlóság függvényében A skála az illesztett fehérjeszekvenciák közötti százalékos egyezést mutatja Két véletlen szekvencia illesztése ~20 %egyezést mutat 20 % alatt nem szignifikáns az illesztés

9 Homológia és hasonlóság A homológia fogalmát gyakran hibásan használják Két szekvencia homológ, ha közös őstől származik Az analóg szekvenciák olyan nem homológ szekvenciák, amelyekben hasonló szerkezetű részek vagy hasonló funkcionális helyek találhatók, és ezek konvergens evolúcióval jöttek létre A homológia nem a hasonlóság mértéke Az olyan kifejezések, mint „a szekvenciák 50 %-banhomológok” vagy „a szekvenciák nagyfokú homológiát mutatnak”, értelmetlenek A hasonlóság egy tény, a homológia egy hipotézis ill. következtetés A hasonlóság kvantitatív, a homológia kvalitatív

10 Alapfogalmak Szekvencia illesztés ->Homológia-vizsgálat kimutathatja: Leszármazási viszonyokat Szerkezetet illetve funkciót mutathat Szekvencia hasonlóság, szerkezeti és ezáltal funkcionális hasonlóságot mutat

11 Szignifikancia A matematikai és a biológiai szignifikancia különbözik Pl. kis komplexitású régiók, konvergens evolúcióval létrejött hasonlóság Ebből fakadó korlátok Az adatbázis-kereső algoritmusokban A szekvenciaillesztő algoritmusokban A mintázat-felismerési módszerekben A funkcionális hely-és szerkezetpredikciós eszközökben Ezért mindig ajánlatos a szekvenciaelemző módszerek széles körét alkalmazni Egyik módszer sem tévedhetetlen!

12 Szekvencia illesztés során az evolúciós változások figyelembe vehetők Pl. ha van 2 rokon fehérje, ugyanaz a funkciója Ha egymáshoz illesztjük a szekvenciát sok eltérés lehet Ettől még hasonló A helyettesítési mátrixok ezt veszik figyelembe

13 Változások az evolúció során Nukleotid sorrendben Pontmutáció: tranzíció, transzverzió Nukleotid szubsztitúció: pontmutáció SNP – single nucleotide polymorphism Szegmentális mutáció: del, in, inv – ha nem egy nukleotidot érint Szinonim ill. nem-szinonim szubsztitúció - vigyázat! – nem biztos, hogy a szinonim szubsztitúció kihatás nélküli – pl. splicing megváltoztatása Nukleotidok nem-random előfordulása: a 4 bázist tartalmazó nukleotidok nem 1:1:1:1 arányban találhatók a genomokban; Dinukleotidok nem-random előfordulása: funkcionális kényszerek a genetikai kód miatt

14 Nukleotid sorrendben (folyt.) Nem-random a szinonim kodonok használata: RSCU – relative synonymous codon usage n = a szinonim kodonok száma egy aminosavra (1 – 6) i = egy adott kodon X i = egy adott kodon előfordulási száma ha azonos gyakorisággal használtak, akkor az RSCU-k összege 1 Effektív kodonszám: ENC 20 – 61: 20 – minden aminosavra egy kód 61 – teljesen random, nincs kiemelt kód

15 Helyettesítési modellek (nukleinsav) Kodonhasználat: nem teljesen univerzális a genetikai kód: mitochondriális genom, néhány prokarióta, egysejtű, ill. gomba spec. kodonokkal rendelkezik nem teljesen univerzális a genetikai kód: mitochondriális genom, néhány prokarióta, egysejtű, ill. gomba spec. kodonokkal rendelkezik hiányzó kodonok: néhány szervezetben a fehérjéket kódoló régiókban sosem fordulnak elő bizonyos kodonok hiányzó kodonok: néhány szervezetben a fehérjéket kódoló régiókban sosem fordulnak elő bizonyos kodonok hozzá nem rendelt kodonok: a kodon megtalálható, de nincs hozzá tRNS a megfelelő antikodonnal – leáll a transzláció, a polipeptid a riboszómához kötötten marad hozzá nem rendelt kodonok: a kodon megtalálható, de nincs hozzá tRNS a megfelelő antikodonnal – leáll a transzláció, a polipeptid a riboszómához kötötten marad Azonossági (szubtitúciós) mátrix nukleotidokra Pl: egyezés 1, mismatch 0 (vagy egyezés 5, eltérés -4) Esetleg súlyozható Tranzíció kisebb súllyal Transzverzió nagyobb súllyal (előadás későbbi részében)

16 Szekvencia változások az evolúció során Aminosav/fehérje szinten Aminosav kémiai tulajdonságait, hasonlóságait figyelembe vevő márix A hasonló fiziko-kémiai tulajdonságokkal rendelkező aminosavak illeszkedését nagyobb súllyal veszi figyelembe (osztályozás alapja: poláros vagy apoláros, méret, alak, töltés) Észlelt helyettesítéseken alapuló szubsztitúciós mátrixok Az illesztett szekvenciákban észlelt aminosav-helyettesítési gyakoriságokon alapulnak Fehérjeszekvenciák illesztésénél ma már szinte csak ilyeneket használnak Pl: PAM, BLOSUM

17 Észlelt helyettesítéseken alapuló mátrix Dayhoff mutációs mátrix Közeli rokon szekvenciák illesztéséből (legalább 85% hasonlóság, 70 illesztés, 2450 helyettesítés megfigyeléséből) PAM mátrix létrehozása (log odds mátrix) PAM = Percent Accepted Mutation 1 PAM az adott evolúciós időtartam alatt 1 aminosav kicserélődése elfogadott (accepted) 100 aminosav esetén (1%) Feltételezés: a mutáció független az aminosavtól (hogy mi volt előtte) és a pozíciótól (hol helyezkedik el a szekvenciában) A fenti alapján interpolálható az aminosavak változása PAM1xPAM1=PAM2 (kétszer olyan távoli esemény esetén az aminosav változás) PAM250 (PAM1 250 ) kb. 20% aminosav azonosságot jelent

18 Helyettesítési mátrixok BLOSUM mátrixok BLOCKS adatbázisból származó adatokból Távolabbi rokon szekevenciák hézag nélküli blokkjainak többszörös illesztése BLOcks SUbtitution Matrix BLOSUM Log odds mátrix

19 BLOCKS adatbázis —> BLOSUM Többszörös illesztés -> blokkok Rokon szekvenciák hézag nélküli blokkjainak többszörös illesztése Nincsenek hézagok, konzervált régiók -> megbízhatóbb illesztése Klaszterezés páronkénti hasonlóság alapján pl. minden szekvencia 80% hasonlóságot mutat minden másikkal Ebből helyettesítési gyakoriságok számolása -> mátrix Pl: BLOSUM80

20 Hogyan készül a mátrix Általános képlet (log odds) S ij pontérték mátrixelem (Score az adott mátrix elemre, negatív várható pontérték random szekvenciákra) λ=pozitív konstans q ij észlelt aminosavpár gyakoriság az illesztésekben (célgyakoriság, ∑=1) p i és p j aminosav előfordulási gyakoriságok az adott aminosavra (háttérgyakoriságok)

21 BLOSUM62 mátrix

22 Páronkénti összehasonlítás Pontábrázolás (dotplot)

23

24 A dotplotok értelmezése

25 Fehérje dotplot

26

27 Nukleinsav dotplot

28 Illesztés pontozása Helyettesítési mátrixból vett pontértékek Pl: PAM 250 helyettesítési mátrix felhasználásával 1. szekv.M N A L S D R T 2. szekv.M S D R T T E T pont = 7

29 BLOSUM62 helyettesítési mátrix

30 Páronkénti illesztések Optimális illesztések: Globális és lokális illesztés

31 „Optimális” illesztések Szekvencia-illesztés(„alignment”): két szekvencia olyan elrendezése, amely megmutatja, hogy a két szekvencia hol hasonlít, illetve hol különbözik egymástól hipotézis: pozícionális homológia Optimális illesztés: a legtöbb egyezést és a legkevesebb különbséget mutató szekvenciaillesztés Matematikailag optimális, azaz az alkalmazott pontozási rendszerrel a legnagyobb pontértéket mutató illesztés Hogy egy adott esetben a nagyszámú lehetséges illesztés közül melyik lesz optimális, az nagymértékben függ az alkalmazott pontozási módszertől!

32 Páronkénti illesztés: lokális vagy globális

33 Hézagok pontozása (gap penalty) Lehet fix, de általában a hézag hosszával növekszik „Affin” hézagbüntetés (w x, két részből áll): Hézagnyitási büntetés (nagy): g Hézagkiterjesztési büntetés (kisebb): rx w x =g+rxahol x a hézag hosszúsága A pontozási mátrixtól függetlenül is módosíthatók, de a pontozási mátrix korlátozza, hogy milyen határok között Az alapértelmezett értékek általában tapasztalati úton lettek beállítva, és tipikus feladatokra jól használhatók, pl. BLAST-nál

34 Páronkénti illesztés algoritmusa

35 Az illesztési mátrix kitöltése (H ij értékek)

36 Az illesztések eredménye Két alternatív globális illesztés sequence 1 M - N A L S D R T sequence 2 M G S D R T T E T Score = -5 sequence 1 M N - A L S D R T sequence 2 M G S D R T T E T Score = -5 Globális illesztés, de nincs hézagbüntetés a végeken sequence 1 M N A L S D R T Sequence M G S D R T T E T Score = 10

37 Többszörös illesztés Multiple sequence alignment (MSA vagy msa) Kettőnél több szekvencia optimális illesztése Célja hogy minél több egyező karaktert (nukleotid, vagy AA) egy oszlopba rendezzen Tartalmazhat illeszkedést (match), nem illeszkedést (mismatch) és hézagokat (gap) (emiatt bonyolult probléma

38 Többszörös illesztési megközelítések Dinamikus programozás kiterjesztése Progresszív globális illesztés Iteratív módszer Motívumokat felhasználó illesztés Statisztikai módszerek probabilisztikus modellek felállításával

39 A többszörös illesztésben lévő információ Egy adott szekvencia készlet többszörös illesztése úgy tekinthető, mint a Szekvenciák evolúciós töténete Azok a szekvenciák, amelyek jól illeszkednek, valószínűleg később divergálódtak a közös ős szekvenciától Olyan szekvencia csoport, amelyik rosszabbul illeszthető, komplexebb és távolibb evolúciós kapcsolatot mutat

40 Az illesztés megvalósítása egyenértékű a szekvenciák közötti evolúciós kapcsolatok feltárásával

41 Többszörös illesztés Nehéz vagy bonyolult feladat? Nagy hasonlóság esetén triviális Inzerciók, deléciók esetén nem hogy nem triviális, hanem még számítógépekkel is bonyolult feladat

42 Felhasználás Szekvenálás (genom szekvenálás, shotgun szekvenálás) Strukturális funkcionális részek azonosítása Fehérjében, domén vagy katalitikus aminosav Nukleotid szekvenciában pl: promóter fehérje kötő hely stb.

43 Felhasználás Új szekvenciák és meglévő családok közötti hasonlóság (és homológia) felderítése Másodlagos és harmadlagos fehérje szerkezetek előrejelzésének segítése (pl. homológia modellezés) Oligonukleotid primerek tervezése Filogenetikai analízis alapfeltétele

44 MSA és evolúciós fa kapcsolata Optimális illesztés minimalizálja a fán a mutációs lépések számát

45 MSA dinamikus programozási algoritmussal Probléma 2 szekvencia összehasonlításánál Az összehasonlítások száma NxM, ahol N az egyik szekvencia hossza, míg M a másiké Tegyük fel, hogy a két szekvencia egyforma hosszú, N=M, ekkor az összehasonlítások száma N 2 10 szekvencia esetén az összehasonlítások száma N 10 pl. 10db 300 AA hosszúságú fehérje esetén =5,9x10 24

46 Scoring mátrix 3 szekvenciára A szekvencia B szekvencia C szekvencia A-B B-C A-C MSA (A-B-C)

47 Egyszerűsítés

48 Progresszív módszer ClustalW (a leggyakrabban használt program) 1. minden szekvencia páros összehasonlítása 2. az illesztési pontértékek felhasználása filogenetikus fa készítéséhez (vezérfa) 3. egymás utáni szekvencia illesztés a vezérfa alapján Először a leghasonlóbb szekvenciák illesztése történik meg, majd ehhez illeszti az egyre kevésbé hasonlító szekvenciákat

49 Clustal Távolságmátrix a páros illesztésekből Vezérfa szerkesztése Illesztés a legnagyobb hasonlóságot mutató szekvenciák illesztésével

50 Legfőbb probléma a progresszív illesztéssel, hogy a kezdeti illesztéstől nagymértékben függ a többszörös illesztés Ha hasonló szekvenciákra nézzük, akkor jó eredmény Az elején beillesztett gap pl. nem módosul az illesztés során vagy a korán elkövetett illesztési probléma kihat az egész illesztésre (lokális minimum probléma, az algoritmus „greedy” mohó természetéből fakad

51 Iteratív módszerek pl. MultAlign Újraszámolja a páros illesztések pontértékeit a progresszív illesztés során Az újraszámolt pontérték alapján új fát készít Az új fa alapján javítja az illesztést

52 Genetikus algoritmus Alapötlet Sokféle illesztést generálunk átrendeződésekkel, és rés beépítésével egy egy generáció során Az utódok (illesztések) közül kiválasztjuk legjobb pontértéket adót

53 Profil alapú illesztés Helyi hasonlóságok felhasználása az illesztésekben Profil analízis Kisebb hasonló (nagymértékben konzerválódott) darabokat illeszt (nem globális) A hasonló darabok alapján profilt (egyfajta pontozási mátrixot képez) Ebben benne van az aminosavak helyettesítési értéke is Réseket is magában foglalja

54 Statisztikai módszerek Rejtett Markov Láncok

55 Statisztikai módszerek Rejtett Markov Modell (Hidden Markov Model, HMM)

56 HMM Valószínűségelméleti leírása a szekvencia illesztésnek Statisztikai modell Minden lehetséges illeszkedő/nem illeszkedő pozíciót és rést figyelembe vesz az msa generálásához A szekvencia családból modell készül (előzetes/priori információból kiindulva darabos szekvencia készlet használható a modell tanítására A tanított modell használható az msa létrehozására (posterior információ)

57 Hasonlóság keresés A probléma: Van egy szekvenciánk, amiről nem tudunk semmit Van az adatbázis, ahol a már ismert/jellemzett szekvenciákat letárolták Hasonlítsuk össze a „saját” szekvenciát az adatbázisban találhatókkal Ha szekvencia egyezést, vagy hasonlóságot találunk, akkor a funkcióra következtethetünk

58 A korábbi illesztés (Smith-Waterman, Nedleman-Wuntsch) nagyon jó, de lassú, ha nagy adatbázisok vannak Heurisztikus megoldások (nem minden illesztés jön ki, de gyors)

59 FastABLASTPSI-BLAST

60

61

62 BLAST Leggyorsabb (akár helyi gépeken is használható) Gyors lokális illesztéseket végez Statisztikai módszerek alkalmazásával becsüli a találatok szignifikanciáját

63

64 Statisztikai szignifikanciabecslés: E érték: hasonló vagy nagyobb pontértékű találat véletlen előfordulásának várható száma; minél kisebb, annál jobb.

65 Promóter predikció

66 Feladatok: 1. Feladat: PubMed keresés Hány xilanáz-ról (növényi sejtfalbontó enzim, xyalanase) szóló publikáció van a PubMed adatbázisban? Mennyi jelent meg 2000-ben? Ebből hány publikációban szerepelt Gilbert nevezetű szerző?

67 2. Feladat: BLAST keresés CGCATCGTCGGCATATGGTTCGGTGAGCGCTACCCTGGCGCACTTATTGGACTTCCGACGGGCGAGCCTCTTGGCGC ATGGGTTCTCGACCTTGACCGACATGGCGATCGTGACGGGCATGCGTGGCTCGCCGAGATGGAGGCGAAGCACGGC GCGCTGCCCGAAACAGCAAGAGCCAGCACGGCCAACGGTGGAACGCACATATTCTTCAAGCACGTCGCCGGCATTCG CAACCGTGCGGCAATCGCGCCTGGTGTGGATACTCGAGGAGATGGCGGCTATGTCTGCGGGCCTGGCTCGCAAATG GCCGATGGCCGAAGATACCAGTGGATCGACTACGATGGAGACGGGCTGCCTCCCATCGCGGATGCCCCTGCATGGCT CATCGACCTGCTGAAGCCGAAGGTGGTGGAAGCCGCCGAAAGGCGCCAGCCGTCCACATACACATACCAGCCGGAG GATAGCGGCGCTGCTCGCTATGCCGCCAAGTCCTTTGAAATGGAGCTCGAGAAGCTGCGCAACTCGCCCAGCGGCCA GCGCGGTCAGCAGTTGTTCGCCAGCGCGTGCTCCATCGGTGAGTTCGTTGCCGGAGGCCTGATTTCACGATCGGAGG CCGAGGCTGGTCTGCTGGACGCGGCAGCGGCGTGCGGCGTGCTCCAGAAGGACGGCGAGCGAAAGACTGTGGACC GTATCCGGCGAGGGCTGGACAAGACGGCGAACACGCCGCGGCAGATACCGGAGCGCGAATATGACAACGACAACAC GCCAGTAAACGCTGCGGAAATGGAGGCTTTCGTCGAGCGGCACAAGGCCAAGAAGGAGGCGGCAGCGCAGCAACAA ACCGCCGTTGTTGAGGAGCAGCCACCAGCCGACCAGGCACCGACGCCCCGCCAGAAGGCCCGATTCGAACTGACGT GGTTCGATGACATCGAGGAGGGCAAGCCGAAGGAGACCATCCTCAAGGGCTGGCTAGGCGTTGGCGAATTCACCACC ATCTCGGGCCTGCCGGGAACTGGCAAGAGCGTCGTGACAACCGACCTGGCTTGCCACATCGCGGCTGGCATGGACT GGCATGGCATGAAGGTCCAGCAGGGCCTGGTTGTCTACGTGGCGGCCGAGCGCAAGAAGCTGACGGAGCGGCGCAT GATGGCCTTCCGCAAGCACCATAACAAACACAACGTGCCCCTTCTCGTCGTAGGCGGCATGCTGGACTTTACCCGCGA TCTGAAGGACGCCGAGGACATAATCAAGGTGATCAGGGAGGCGGAAACCATCACAGGCATGAAGTGCGTGTGGGTCA TTATCGACACGCTCACCCGCACATTCGGAGCCGGCGACCAGAACGCATCCAAGGATATGGTGAAGTTCGTTCGATCCT GCGACAAAATCGTAGAGGACATCGGGGCGCATGTTACGGCTATCCACCATTCATCGTGGAACGGTGAGCGAGGGAAG GGCGCCATCGACCTGGACGGGGCAGTCGATGCTTCATTCATGGTGAAGAAGGACGGCAACAAGCACAGACTCGTCTG CGACGGGACCAACGACGGAGAGGATGGCGACGTGCTGGCCTTCACCATGCAATCCGTT Mi lehet a funkciója a következő szekvenciának? Miből származhat a szekvencia nagy valószínűséggel?

68 3. Feladat: Primer tervezés Az adatbázisból keresse ki az Azotobacter vinelandii ANFH (alternatív nitrogén fixálás) génjét Töltse le a szekvenciát Keresse ki a Chlamydomonas reinhardtii aktin génjét (actin) Töltse le a szekvenciát Tervezzen primer párt az ANFH génre, ami 450 bp hosszúságú szakaszt amplifikál. Tervezzen primer párt az actin génre, amely 525 bp hosszúságú szakaszt amplifikál. Mire kell figyelni a Chlamydomonas primer tervezésénél? (Eukarióta szervezet!)


Letölteni ppt "Bioinformatika gyakorlat (biomérnök hallgatóknak) Adatbázisok Szekvencia illesztés Hasonlóság keresés Filogenetikai programok PCR primer tervezés Promóter."

Hasonló előadás


Google Hirdetések