Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

A minimális sejt és az anyagcsere autokatalitikus magja Biokémia II – Anyagcsere Dr. Kun Ádám, Ph.D. okleveles biológus, okleveles vegyész.

Hasonló előadás


Az előadások a következő témára: "A minimális sejt és az anyagcsere autokatalitikus magja Biokémia II – Anyagcsere Dr. Kun Ádám, Ph.D. okleveles biológus, okleveles vegyész."— Előadás másolata:

1 A minimális sejt és az anyagcsere autokatalitikus magja Biokémia II – Anyagcsere Dr. Kun Ádám, Ph.D. okleveles biológus, okleveles vegyész

2 Az RNS Világ

3 A DNS / fehérje világ előtt… Ma élő élőlényekben  Az információDNS-ben tárolódik  Fehérjék az enzimek FehérjeDNS Kódolja Replikál Monomert állít elő

4 … egy RNS világ volt RNS enzimként is működhet és információt is tárolhat! DNS stabilabb és a fehérjék jobb enzimek RNS Replikálódik, hogy enzimet kapjunk Reakciókat katalizál, monomert állít elő

5 RNS világ bizonyítékai a mai szervezetek biokémiájában I Természetes RNS enzimek (ribozim) Mindegyik RNS hasítást katalizál –I. Csoportbeli intronok –II. Csoportbeli intronok –RNáz P –Kalapácsfej –Hajtűhurok –Hepatitis Delta Vírus –Neurospora Varkund Satelite RNA Joyce, G. (2002) Nature 418: alapján

6 RNS világ bizonyítékai a mai szervezetek biokémiájában II: Koenzimek   Koenzimek: valamilyen specifikus kémiai csoport átadásában résztvevő metabolitok (rengeteg reakcióban) – –Acetyl koenzim A (koenzim A): acetyl csoport – –NADH, FADH 2 (NAD +, FAD): hidrogén és elektron – –ATP (ADP): nagyenergiájú foszfát ATP CoA FAD NADP NAD

7 RNS világ bizonyítékai a mai szervezetek biokémiájában III  Dezoxi-ribonukleotidok ribonukleotidokból keletkeznek (de ezt valószínűleg ribozimek nem tudják katalizálni).  Riboswitches: Génreguláció vélhetően legősibb formája. Az mRNS térszerkezete határozza meg, hogy lefordítódik fehérjévé.

8 RNS világ bizonyítékai a mai szervezetek biokémiájában IV: Transzláció  mRNS  tRNS  riboszóma A DNS  fehérje „átmentet” (transzláció) RNS közvetítésével történik Riboszómában a peptidil transzfert egy ribozim végzi!

9 RNS világ lehetőségei:  RNS szintézis: Nukleotid képzés pirimidinből és aktivált ribózból; Polinukleotidok 5’ foszforilációja; 5’ foszfát aktiválása 5’,5’ pirofoszfát kötött nukleotid kapcsolással; Ligáz aktivitás;  Legjobb szintetáz kb. 200 bázis hosszú és 14 nuklotidot tud egy templát alapján hozzákapcsolni egy oligonukleotid lánchoz 97.5%-os másolási hűséggel.  Protein szintézis: Minden lépés megoldható. Aminosavak aktiválása (sokféle aminoaciláció); Peptid kötés kialakítás (peptidil transzfer)  Membrán transzfer  Redoxi reakciók (NAD függő alkohol dehidrogenáz)  Egyéb reakciók (amid kötés bontás, alkiláció, porfirin metiláció, kén alkiláció, Diels-Alder cikloaddíció, amid kötés kialakítás, hidas bifenil izomeráció)

10 Információ replikáció Eigen Paradoxona

11 Információ replikáció  A replikáció nem hibátlan (főleg nem replikáz és javító mechanizmusok nélkül)  A másolás pontossága korlátozza a fenntartható információ hosszát.  Mekkora információ (milyen hosszú RNS szál) tartható meg adott másolási pontosság mellett?

12 „Replikáció” egy példája RNA RGA RNA RNX RNA RNH DNM RNA RQA RNA RNJ RPA WORLD WORLF WORLD WORLL IDRYD WORLD KORLD WORLD WERLD WORUD WORLD WORHD WORLD WORWD WORLD WRRLD HYPOTHESIS EYPKTHYSII HYPEXHESIS HYPOTHESIS HYPETHESKS HYYOTHESIS HYPOTHESIS HYPOSHESIS HYPOTMESIS HTPOTHESIS CYPOTGESIS HYPOTHEGIA HYPOXHLSIS HYPXTHESIS HYPOTHESIS HYPUTHESIS

13 Nhossz lns a mesterkópia szelekciós fölénye q másolási pontosság Eigen Pradoxona és a hibaküszöb Nincs enzim nagy genom nélkül, és nincs nagy genom enzim nélkül Swetina és Schuster 1998 alapján

14 Szekvencia vs. Szerkezet DNS fehérje Átíródik ATCGTCTGTCGGCGAT GCATGACTCATATGC A szekvenciát kell megtartani Mutáns : rátermettség 0 GCAUGACUCAUUAUGC Structure has to be maintained Mutáns : Azonos rátermettség RNS AUCGUCUGUCGGCGAU

15 1D-2D-3D szerkezet AAACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAUAUUACCUGGUA

16 RNS szerkezet  Az enzimaktivitás a szerkezettől függ  A ribozim fenotípusa a szerkezete  Kevesebb szerkezet van, mint szekvencia  Egy kevés mutáció általában nem változtatja meg a szerkezetet  Szerkezet könnyebben fenntartható, mint a szekvencia. (fenotipikus hibaköszöb)

17 Az élet kódja: Transzláció A genetikai kód eredete

18 Transzláció eredete  Fehérjék jobb katalizátorok (4 kémiailag hasonló bázis vs. 20 kémiailag sokféle aminosav)  Mivel az RNS központi szerepet játszik a transzlációban, így valószínűleg az RNS világban „találták fel”

19 Kódtábla

20 Néhány tény a genetikai kódról  Közel univerzális  Redundáns  Miért triplet? –A triplet optimális a reverzibilis kapcsolódáshoz  Miért 20 aminosav? –Az enzim sokféleség növekszik a több aminosavval, de a mutációs robusztusság csökken.  A kód optimálizált mutációs robosztusságra

21 A megfejtetlen rejtély RNS Oligo-nukleotidok ásványi felszínen nukleotidok ribozimok

22 DNS A megfejtetlen rejtély fehérje RNS Kódolja replikálja monomert állít elő Membrán monomert állít elő

23 Anyagcsere

24 Minimális sejt

25 Minimum sejt  Top – down: Meglevő szervezetek genomjából indulunk ki  Bottom – up: Minimális funkciók, élő sejt szintézise

26 Minimum sejt – felülről lefelé  A gének legkisebb lehetséges halmaza, amivel fenntartható egy működő sejt a legjobb körülmények között (minden forrás rendelkezésre áll, nincs környezeti stressz)  Bioinformatika  Knock-out kísérletek  206 gén

27 Konzerválódott fehérjék  Legjobban a transzláció és az RNS polimerázok konzerválódtak  Metabolizmusban viszont kevés konzerválódott (több genom összehasonlításában) enzim van  A konzerváltság nem jelenti, hogy laborban elengedhetetlen (kilőhető). Például repair nélkül a sejt jól él, de fennmaradhat-e?

28 Minimum sejt – funkciók I 1.DNS metabolizmus (replikáció, módosítás, javítás és hasítás) 16 gén 2.RNS metabolizmus (transzkripció, transzláció, RNS degradáció) 106 gén 3.Fehérje feldolgozás (módosítás, felgombolyodás, áthelyezés, lebontás) 15 gén 4.Sejtszintű működés (osztódás, transzport) 5 gén

29 Minimum sejt – funkciók II  Köztes metabolizmus és energetika 1.Glikolízis (10 gén) 2.ATP szintézis, H + gradiens (9 gén) 3.Pentóz-foszfát út (3 gén) 4.Lipid metabolizmus (7 gén) 5.Nukleotid bioszintézis (15 gén) 6.Kofaktor bioszintézis (12 gén) 7.Egyéb (8 gén)

30

31 Az Élet Szikrája az anyagcsere autokatalitikus magja  Mitől több – ha több - az élő sejt egy zsák enzimnél és némi DNS-nél?  Mitől lesz élő egy sejt?

32 Gánti kemoton elmélete

33 Egy zsák enzim és DNS  Legyen egy sejtünk, amiben csak enzimek és DNS (RNS) van.  A környezetben minden tápanyag jelen van, amit az élőlény fel tud venni (optimális mennyiségben) Enzimek DNA/RNA Nincsen kis molekulasúlyú metabolit! H 2 O, H +, CO 2, Fe 2+, CNO, NO 2 -, NO 3 -, HPO 4 2-, SO 4 2-, O 2, cukrok, aminosavak, alkoholok

34 Egy zsák enzim és DNS  Működőképes-e ez a sejt?  Kell-e valaminek eleve a sejtben lennie, hogy a metabolizmus beinduljon? Enzimek DNA/RNA ??? H 2 O, H +, CO 2, Fe 2+, CNO, NO 2 -, NO 3 -, HPO 4 2-, SO 4 2-, O 2, cukrok, aminosavak, alkoholok

35 Elméleti kísérlet!  Legyen egy reakcióhálózatunk  Adjuk meg a felvehető anyagok listáját  Mi termelhető meg a reakciólista alapján? 1.Ha minden megtermelhető, akkor az élő sejt nem több egy zsák enzimnél. 2.Ha nem termelhető meg minden, akkor mi kell még?

36 Reakcióhálózatok  Eubacteria –Escherichia coli –Heliobacter pylori –Staphylococcus aureus –Lactococcus lactis –Streptomyces coelicolor –Geobacter sulfurreducens –Synechocystis  Archea –Methanosarcina barkeri  Eukarióta –Saccharomyces cerevisiae  Minimális metabolizmus

37 Escherichia coli  Reakció szám: 931  Metabolitok száma: 761  Megtermelhető metabolitok: 692  Külső molekulák: 53  Makromolekulák: 3  Külső molekulákból megtermelhető: 315  Hozzáadandó: ATP

38 Az anyagcsere autokatalitikus magja  Escherichia coli  Heliobacter pylori  Staphylococcus aureus  Lactococcus lactis  Streptomyces coelicolor ATP

39 Az anyagcsere autokatalitikus magja  Methanosarcina barkeri  Geobacter sulfurreducens  Synechocystis ATP + NAD ATP + NAD + THF + CoA ATP + NAD + THF + CoA + cukor

40 Autokatalitikus molekulák  ATP  NAD (NADP)  Koenzim A  THF  Kinon  Cukor ATP CoA NAD

41 Az Élet Szikrája ATP = energia eleve kell a szervezeteknek, hogy éljenek.

42 Anyagcsere főbb útvonalai

43  Szénhidrát metabolizmus –Glikolízis –Pentóz foszfát út –Citromsav ciklus  Energia metabolizmus –Oxidatív foszforiláció –Calvin ciklus  Lipid metabolizmus  Nukleotid bioszintézis –Purin metabolizmus –Pirimidin metabolizmus  Aminosav metabolizmus  Nucleotid Salvage Pathway  Kofaktor bioszintézis

44 Glikolízis

45 Pentóz-foszfát út

46 Citromsav ciklus

47 Lipid metabolizmus

48 Calvin ciklus

49 Anyagcsere autokatalitikus magja

50 Ajánlott irodalom  John Maynard-Smith és Szathmáry Eörs: Az evolúció nagy lépései. Scientia, Budapest, 1997  Bálint Miklós: Molekuláris biológia I-II. Műszaki könyvkiadó, Budapest, 2000  Ádám Veronika (szerkesztő): Orvosi biokémia. Semmelweis, Budapest, 1996  Láng Ferenc (szerk.): Növényélettan. Eötvös Kiadó


Letölteni ppt "A minimális sejt és az anyagcsere autokatalitikus magja Biokémia II – Anyagcsere Dr. Kun Ádám, Ph.D. okleveles biológus, okleveles vegyész."

Hasonló előadás


Google Hirdetések