Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Természet Világa. Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai.

Hasonló előadás


Az előadások a következő témára: "Természet Világa. Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai."— Előadás másolata:

1 Természet Világa

2 Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai Tanszék

3 A megfejtetlen rejtély: az élet keletkezése  Tudjuk, hogy van élet  Ha találunk egy utat, akkor sem lehetünk biztosak benne, hogy azt az utat járta be az Élet

4 Életet teremteni egyszerű…

5 Életet „élettelenből” előállítani kevésbé...

6 Az élethez vezető út Joyce 2002 Nature 418:214 1.Kémiai sokféleség kialakulása 2.Sokszorozódás kialakulása, kémiai evolúció 3.Templát alapú replikáció 4.Templát vezérelt anyagcsere 5.Protosejt

7 Út az élethez – Az összetettség növekedése Monomer Makromolekula Funkció szerzés Protosejtté integrálás

8 Funkció szerzés AnyagcsereEnzim Információ hordozó molekula Kódolja Replikál/Másol Alapegységet állít elő Membrán Alapegységet állít elő Elhatárol

9 Kémiai sokféleség kialakulása Avagy hogyan lehet hihető prebiotikus szintézissel előállni a fontos molekulákra

10 Prebiotikus szintézis  Kiindulási anyagok elérhetőek prebiotikus körülmények között (azaz csak olyan anyagokkal dolgozhatunk, ami jelen volt akkor a Földön)  A szintézis útja elképzelhető prebiotikus körülmények között (azaz olyan körülmények között játszódhat a reakció, ami reális, például tömény kénsavas közeg, van szerves oldószer nem)

11 Funkció – kémiai sajátság ma FunkcióMonomer Makromolekula katalizátor (enzim) aminosav fehérje információ hordozó nukleotid (bázis, cukor) DNS / RNS membrán zsírsavak micella, lipid vezikulum

12 Aminosavak - Miller-Urey kísérlet  Metán (CH 4 )  Ammónia (NH 3 )  Hidrogén (H 2 )  Víz (H 2 O)  Elektromos kisülés Aminosavak (glicin, szarkozin, alanin)

13 Formóz reakció

14 Cianid polimerizáció

15 Makromolekulák  Peptidek nem keletkeznek az aminosavakból (max. dipeptidek)  Nukleotidok nem állnak össze (na ez azért gyorsan megoldódhat), viszont nukleotidokból oligomerek igen.  Lipidek összeállnak vezikulákká, micelláká! De magunak a lipideknek a keletkezése nem megoldott

16 Makromolekulák: Oligonukleotidok  tagú oligomerek montmorillonit agyag felszíneken előállnak  Montmorillonit vulkanikus hamuból keletkezik

17 Membrán kialakulás A micellák és membránok autokatalitikusan kialakulnak Ön-összeszerelődés (self-asembly)

18 Az élet építőkövei A monomerek és makromolekulák prebiotikus szintézise FunkcióMonomer Makromolekula katalizátor (enzim) aminosav fehérje ? információ hordozó nukleotid (bázis, cukor) ? DNS / RNS membrán zsírsavak ? micella, lipid vezikulum

19 Funckió? Szép, hogy vannak molekuláink, de mire jók? A mai molekulák jók arra amire használjuk őket, de ez nem biztos, hogy csak ők jók

20 Mire van szükségünk?  A felületek előnyösek termodinamikailag  Katalitikus aktivitásuk lehet  Az ásványi felszínek védhetnek az UV sugárzástól  Az ásványi felszínek elősegíthetik a homokiralitást Anyagcsere Előálljon minden amire szükségünk van. Katalizátorok Kémiailag sokfélét ismerünk. Ásványi felszínek Kompartmentalizáció Amit előállítottunk az ne menjen el. Felületek Ásványi felszínek

21 Miért kellenek katalizátorok?  Reakciók lassúak ( pl. vízkilépés, CO 2 )  Reakciók lassúak ( pl. vízkilépés, CO 2 megkötés ) –Gyorsabbnak kell legyen a lebomlásnál –Térszerkezeti problémák  Reakciók nem specifikusak (rengeteg mellékreakció is végbemegy)  Nem sztereospecifikusak, racém keletkezik

22 Racém, kiralitás   Számos molekula királis, azaz két változata van, amely fedésbe nem hozható, hasonlóan a két kezünkhöz.   A két enantiomer biológiai hatása eltérő lehet   Racém monomerből nem lehet „rendes” polimert előállítani. D-alanin L-alanin D-glükóz L-glükóz

23 1. 1.Kémiai sokféleség kialakulása 2. 2.Sokszorozódás kialakulása, kémiai evolúció 3. 3.Templát alapú replikáció 4. 4.Templát vezérelt anyagcsere 5. 5.Protosejt

24 Az RNS Világ

25 A DNS / fehérje világ előtt… Ma élő élőlényekben  Az információDNS-ben tárolódik  Fehérjék az enzimek FehérjeDNS Kódolja Replikál Monomert állít elő

26 … egy RNS világ volt RNS enzimként is működhet és információt is tárolhat! DNS stabilabb és a fehérjék jobb enzimek RNS Replikálódik, hogy enzimet kapjunk Reakciókat katalizál, monomert állít elő

27 RNS világra utaló körülmény a mai szervezetek biokémiájában I Természetes RNS enzimek (ribozim) Mindegyik RNS hasítást katalizál –I. Csoportbeli intronok –II. Csoportbeli intronok –RNáz P –Kalapácsfej –Hajtűhurok –Hepatitis Delta Vírus –Neurospora Varkund Satelite RNA Joyce, G. (2002) Nature 418: alapján

28 RNS világra utaló körülmény a mai szervezetek biokémiájában II: Koenzimek   Koenzimek: valamilyen specifikus kémiai csoport átadásában résztvevő metabolitok (rengeteg reakcióban) – –Acetil koenzim A (koenzim A): acetyl csoport – –NADH, FADH 2 (NAD +, FAD): hidrogén és elektron – –ATP (ADP): nagyenergiájú foszfát ATP CoA FAD NADP NAD

29 RNS világra utaló körülmény a mai szervezetek biokémiájában III: Transzláció  mRNS  tRNS  riboszóma A DNS  fehérje „átmentet” (transzláció) RNS közvetítésével történik Riboszómában a peptidil transzfert egy ribozim végzi! Nissen P, Hansen J, Ban N, Moore PB, Steitz TA Science 289: 920

30 RNS világ lehetőségei:  RNS szintézis: Nukleotid képzés pirimidinből és aktivált ribózból; Polinukleotidok 5’ foszforilációja; 5’ foszfát aktiválása 5’,5’ pirofoszfát kötött nukleotid kapcsolással; Ligáz aktivitás;  Legjobb szintetáz kb. 200 bázis hosszú és 14 nuklotidot tud egy templát alapján hozzákapcsolni egy oligonukleotid lánchoz 97.5%-os másolási hűséggel.  Protein szintézis: Minden lépés megoldható. Aminosavak aktiválása (sokféle aminoaciláció); Peptid kötés kialakítás (peptidil transzfer)  Membrán transzfer  Redoxi reakciók (NAD függő alkohol dehidrogenáz)  Egyéb reakciók (amid kötés bontás, alkiláció, porfirin metiláció, kén alkiláció, Diels-Alder cikloaddíció, amid kötés kialakítás, hidas bifenil izomeráció)

31 Replikáció  Fejlesztett Bartel I ligáz  20 nukleotid templát alapú hozzáadását képes katalizálni  Másolási pontosság 0.967/bázis

32 RNS Világ fejlődése RNS Oligo-nukleotidok ásványi felszínen Nukleotidok Ribozimok Replikáció szál szétvállás pontosság ACGUGCUGAGCAUUACACGACUCGUAACGUGCUGAGCAUUACACGACUCGUA Replikáz Anyagcsere Kompartmentalizáció Fehérje szintézis

33 Információ replikáció Eigen Paradoxona

34 Információ replikáció  A replikáció nem hibátlan (főleg nem replikáz és javító mechanizmusok nélkül)  A másolás pontossága korlátozza a fenntartható információ hosszát.  Mekkora információ (milyen hosszú RNS szál) tartható meg adott másolási pontosság mellett?

35 „Replikáció” egy példája RNS RGS RNS RNS RNX RNHDNM RNS RQS RNS RNJ RPS VILÁG VILÁF VILÁG VILÁL IDLYG VILÁGVILÁG KILLG VILÁGVILÁG VIJÁG VELÁG VILUG VILÁG VILHG VILÁGVILÁG VILWG VILÁGVILÁG VRLÁG HIPOTÉZIS EIPKTYSII HIPEXÉSIS HIPOTÉZIS HIPETÉZKS HIYOTÉZIS HIPOTÉZIS HIPOSÉZIS HIPOTÉZIZ HTPOTÉZIS CIPOTÉZIS HIPOTÉGIA HIPOXLZIS HIPXTÉZIS HIPOTÉZIS HIPUTÉZIS

36 Nhossz lns a mesterkópia szelekciós fölénye q másolási pontosság Eigen Pradoxona és a hibaküszöb Nincs enzim nagy genom nélkül, és nincs nagy genom enzim nélkül Swetina és Schuster 1998 alapján

37 Szekvencia vs. Szerkezet DNS fehérje Átíródik ATCGTCTGTCGGCGAT GCATGACTCATATGC A szekvenciát kell megtartani Mutáns : rátermettség 0 GCAUGACUCAUUAUGC Structure has to be maintained Mutáns : Azonos rátermettség RNS AUCGUCUGUCGGCGAU

38 RNS szerkezet  Az enzimaktivitás a szerkezettől függ  A ribozim fenotípusa a szerkezete  Kevesebb szerkezet van, mint szekvencia  Egy kevés mutáció általában nem változtatja meg a szerkezetet  Szerkezet könnyebben fenntartható, mint a szekvencia. (fenotipikus hibaköszöb)

39 Az utolsó univerzális közös ős Milyen lehetett az első élő sejt?

40 Transzláció és a genetikai kód eredete  Fehérjék jobb katalizátorok (4 kémiailag hasonló bázis vs. 20 kémiailag sokféle aminosav)  Mivel az RNS központi szerepet játszik a transzlációban, így valószínűleg az RNS világban „találták fel”

41 Néhány tény a genetikai kódról  Közel univerzális  Redundáns  Miért triplet? –A triplet optimális a reverzibilis kapcsolódáshoz  Miért 20 aminosav? –Az enzim sokféleség növekszik a több aminosavval, de a mutációs robusztusság csökken.  A kód optimálizált mutációs robosztusságra

42 Protosejt  Replikáció  Komplex anyagcsere  Membrán / Kompartmentalizáció ? evolúció

43 Az utolsó univerzális közös ős  mRNS proofreading és javítás minden élőlényben azonos. A transzláció és a transzkripció is.  DNS proofreading és javítás nem!  LUCA-nak RNS genomja volt!

44 A megfejtetlen rejtély RNS Oligo-nukleotidok ásványi felszínen nukleotidok ribozimok

45 DNS A megfejtetlen rejtély fehérje RNS Kódolja replikálja monomert állít elő Membrán monomert állít elő

46 Köszönöm a figyelmet!


Letölteni ppt "Természet Világa. Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai."

Hasonló előadás


Google Hirdetések