Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

1 A Biotechnológiai Tanszék oktatási anyaga az alábbi internet címen érhető el:

Hasonló előadás


Az előadások a következő témára: "1 A Biotechnológiai Tanszék oktatási anyaga az alábbi internet címen érhető el:"— Előadás másolata:

1 1 A Biotechnológiai Tanszék oktatási anyaga az alábbi internet címen érhető el:

2 2

3 3 A FEHÉRJÉK TÚLTERMELTETÉNEK ELŐNYEI Fő ok: Ha egy fehérjére nagy mennyiségben van szükség, és a természetben csak kis mennyiségben fordul elő, vagy az eredeti sejtvonal nehezen kezelhető, belõle fehérje csak körülményesen nyerhető. KÖZVETLEN FELHASZNÁLÁS IPARI, proteázok, szénhidrátbontó enzimek, lipázok, polimerázok,bioaktív peptidek, fehérjék, hormonok, farmakológiai, gyógyászati felhasználásra KUTATÁSI CÉLOKRA biokémiai és biofizikai vizsgálati módszerek, 3 dimenziós röntgenszerkezet, mutációs analízis, FELTÉTEL: A felhasználás előtt igazolni kell, hogy az eredeti fehérje és a rekombináns megfelelője biológiailag ekvivalens

4 4

5 5 DNARNA 1 OH 2 U H 3

6 6

7 7 DNS etanollal, izopropilalkohollal kicsapható Kromoszómális DNS nagy, makroszkopikus molekula kiemelhető Minél nagyobb egy DNS, annál könnyebben törik. Kb. 20 kb – osnál nagyobb DNS erős fizikai behatásnak (vortexes kevertetés) nem tehető ki! hordozó Egyéb tisztítási módszerek kromatográfia, - ioncserés DEAE (dietil-aminoetil) kötés alacsony, elúció magas sókoncentráció esetén A DNS savas  ionos kölcsönhatás - szilikagél alapú elválasztás magas sókoncentráció mellett felkötődik a DNS, alacsony sókoncentrációnál eluálódik

8 8 - CsCl sűrűséggradiens centrifugálás adott koncetrációjú CsCl oldat centrifugálás során grádienst képez, a DNS a saját sűrűségének megfelelő helyre vándorol és ott megáll. különböző konformációjú DNS-k szétválaszthatóak, nagy tisztaság RNS tisztítása RNS nagyon könnyen degradálódik, RNázok stabilak a tisztítás során RNáz mentesíteni kell mindent DEPC: dietil pirokarbonát

9 9 sok eltérő protokol, ma univerzálisan használható rendszer a guanidium isotiocianát-fenol- kloroform oldattal történő extrakció egy lépésben sejtfeltárás és szerves-vizes folyadék fázisú extrakció. A vizes fázis csak totál RNS-t tartalmaz ( és némi kromoszómális DNS szennyezést, DNázI kezeléssel eltávolítható RNS tisztítása guanidin és izotiociánsav sója

10 10 mRNS tisztítás eukarióták esetén stabil poliA farok TTTTTTTTTT- hordozóhordozó AAAAAAAAA mRNS tRNS rRNS AAAAAAAAA mRNS TTTTTTTTTT- hordozóhordozó AAAAAAAAA mRNS magas só alacsony só

11 11 DNS ELVÁLASZTÁSA ELEKTROFORÉZIS denaturáló nem-denaturáló lúgos, (DNS, agaróz) formaldehid, glioxál, DMSO (RNS, agaróz) urea (DNS, akrilamid) méret > 50 kb 100bp-50 kb < 1000 bp Mátrix agaróz agaróz % poliakrilamid technika pulzáló gélelektroforézis hagyományos gélelektroforézis (5-20%) hagyományos LÁTHATÓVÁ TÉTEL: etídium bromid, interkaláló festék  nem-denturáló körülmények, első ősorban duplaszálú DNS-t fest, de egyszálú nukleinsavakat is. A DNS 254 nm-en elnyel  energia a festékre  590 nm-en emisszió, a festék maga 302 és 366 nm-en nyel el Lehet gélbe rakni, utófesteni, illetve a mintához adni. Érzékenység kb 10 ng. Egyéb festékek, fluoreszkáló anyagok: pl. fluoreszcein, minden körülményközött radioaktivitás: minden körülmény között, 35 S, 33 P, 32 P beta sugárzók Nincs roncsoló ágens

12 12 DNS IZOLÁLÁSA GÉLBŐL - közös pont: először elektroforetikus úton elválasztjuk a DNS-t - a megfelelő sávot kivágjuk steril pengével AGARÓZ - dialízis, dializáló hártyában, elektrodialízis a kapott DNS további tisztítása fenolos extrakcióval, alkoholos kicsapással, univerzális, széles mérettartomány - - fagyasztásos módszer : a kivágott – DNS-t tartalmazó - agarózdarabot –80 o C-on megfagyasztjuk az agarós szerkezete roncsolódik, ebből a DNS egy szűrőn keresztül centrifugálással kinyerhető további tisztítás szükséges, univerzális - kromatográfiás módszerek 6M NaI mellett a DNS 55 o C-on (az agaróz megolvad) szilikagél felületére kötődik, a mátrix mosása után innen o 55 C-on alacsony só(víz, TE) eluálható, majdnem univerzális, elég széles mérettartomány DEAE membránba futtatjuk a DNS-t, innen magassókoncentrációval (1.5M) magas hőmérsékleten eluálható nagy tisztaság, szűk, alacsony mérettartomány < 1.5 – 2 kb esetén jó a kitermelés POLIAKRILAMID (PAGE) a kivágott darabot passzív módon vagy elektromos térben eluáljuk majd töményítjük, ioncserésen tisztítjuk

13 13 DNS/ RNS MÉRÉSE A különböző nukleotidoknak 260 nm körül erős abszorbanciájuk van. Egyszálú DNS esetén: bázis  (µmol * cm/cm 3 ) dA15.4 dG11.7 dC 7.5 dT 8.8 átlagosan  = 10 (µmol * cm)/cm 3 Ez leginkább oligonukleotidok esetén használatos. Nagyobb egyszálú, kétszálú DNS-k, RNS-k esetén a bázisok kölcsönhatásamiatt a számítás módosul 1 cm-es küvettában 260 nm-en 1.0 az abszorbanciája 50 µg/ml kettősszálú DNS-t 33 µg/ml egyesszálú DNS-t 40 µg/ml egyesszálú RNS-t tartalmazó oldatnak A fehérjék 280 nm-en nyelnek el. Az A 260nm /A 280nm ará’ny a nukleinsav tisztaságára jellemző Egyéb módszerek: fluoreszcein, kemilumineszcens festékekkel. Érzékenyebb, de fluorimétert igényel. A 260nm /A 280nm  2  tiszta a preparátum A 260nm /A 280nm  1 - 1,5  sok a fehérje szennyezés

14 14 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK II típus Speciális célszekvenciát ismer fel és hasítja a DNS-t mindkét szálon a felismerési szekvenciában vagy annak környezetében pl. EcoRI Mg2+ kell Ez a típus az elterjedt

15 15 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK EnzimFelismerőhely hossza Felismerő-hasítóhely Forrás organizmus AluI4 AG/CTArthrobacter luteus HphI5 GGTGAN 8 /Haemophilus parahaemolyticus EcoRI6 G/AATTCEscherichia coli BamHI6 G/GATCCBacillus amyloliquefaciens Ragadós végeket adó hasítások (sticky end) 5' túlnyúló SalI6Streptomyces albis 3' túlnyúló KpnI6Klebsiela pneumonia Tompa végű hasítások (blunt end) HaeIII4Haemophilus aegyptus 5' G TCGAC 3' 3' CAGCT G 3' 5' GGTAC C 3' 3' C CATGG 5' 5' GG CC 3' 3' CC GG 5'

16 16 Isoschisomers AtcI6 5' GGTAC/C 3' KpnI 5' GGTAC/C 3' XmaI6 5' C/CCGGG 3' SmaI 5' CCC/GGG 3' Kompatibilis véget adó enzimek SalI6 5' G/TCGAC 3' XhoI 5' C/TCGAG 3' FEHÉRJE TÚLTERMELTETÉS SZEMPONTJÁBÓL KITÜNTETT ENZIMEK AflIII6 5' A/CPuPyGT 3' BspHI6 5' T/CATGA 3' NcoI6 5' C/CATGG 3' NdeI6 5' CA/TATG 3'

17 17 DNS METILÁZOK - dam metiláz (dezoxiadenin metiláz) 5’ GATC 3’ felismerő hely N 6 pozícióban metilez adenin sok dam metiláz érzékeny enzim van pl. MboI, XhoI, egyenként ellenőrizni kell, érzékenység esetén - dam - törzs használata - nem érzékeny izoskizomer használata (ha van) (MboI - Sau3AI)

18 18 -dcm metiláz (dezoxicitozin metiláz) 5’ CCAGG 3’ vagy 5’ CCTGG 3’, C 5 pozícióban metilez citozin - hasonlóképpen léteznek dcm metiláz érzékeny enzimek - megoldás ugyanaz, mint a dam esetén Sok metiláz van még, hasonló felismerő kanonikus szekvenciával, mint a restrikciós enzimek pl. M. EcoRI metiláz

19 19 Polimerázok 5’  3’ polimeráz aktivitás DNS polimerázoknak primer (indítószekvencia) kell RNS polimerázoknak promóter  DNS függő DNS polimerázok  RNS függő DNS polimerázok  Templátfüggetlen DNS polimeráz  DNS függő RNS polimeráz

20 20 DNS függő DNS polimerázok E. coli DNS polimeráz I aktivitásai: 5’  3’ polimeráz 5’5’ 5’5’ 3’ 5’5’ 5’5’ 5’… p C p A p G p T OH 3’ 3’… p G p T p C p A p A p C p G p G p T p T p … 5’… p C p A p G p T p T P G p C p C p A p A p … 3’ 3’… p G p T p C p A p A p C p G p G p T p T p … E. coli DNS polimeráz I dNTP: dATP, dCTP, dGTP, dTTP E. coli DNS polimeráz I dNTP: dATP, dCTP, dGTP, dTTP

21 21 E. coli DNS polimeráz I aktivitásai: 5’  3’ exonukleáz 5’5’ 5’5’ 3’ 5’5’ 5’5’ 5’C p A p G p T p T P G p C p C p A p A p … 3’ 3’G p T p C p A p A p C p G p G p T p T p … 5’ E. coli DNS polimeráz I 5’ C p C p A p A p … 3’ 3’… p G p T p C p A p A p C p G p G p T p T p … 5’ 3’  5’ exonukleáz 5’5’ 5’5’ 3’ 5’5’ 5’5’ 5’…C p A p G p T p T P G p C p C p A p A OH 3’ 3’…G p T p C p A p A p C p G p G p T p T p 5’ E. coli DNS polimeráz I 5’…C p A p G p T p T 3’ 3’…G p T p C p A p A p C p G p G p T p T p …

22 22 E. coli DNS polimeráz I Klenow fragment és a T4 DNS polimeráz aktivitásai: 3’  5’ exonukleáz 5’5’ 5’5’ 3’ 5’5’ 5’5’ 5’…C p A p G p T p T P G p C p C p A p A OH 3’ 3’…G p T p C p A p A p C p G p G p T p T p 5’ Klenow, vagy T4 polimeráz 5’…C p A p G p T p T 3’ 3’…G p T p C p A p A p C p G p G p T p T p … 5’5’ 5’5’ 3’ 5’5’ 5’5’ 5’… p C p A p G p T OH 3’ 3’… p G p T p C p A p A p C p G p G p T p T p … 5’… p C p A p G p T p T P G p C p C p A p A p … 3’ 3’… p G p T p C p A p A p C p G p G p T p T p … Klenow, vagy T4 polimeráz dNTP: dATP, dCTP, dGTP, dTTP NINCS 5’  3’ exonukleáz 5’  3’ polimeráz

23 23 DNS függő termofil DNS polimerázok

24 24 DNS függő DNS polimerázok 5’  3’ polimeráz3’  5’ polimeráz 5’  3’ exonukleáz DNS polimeráz IVan Klenow (fragment) polimeráz Van Nincs T4 DNS polimeráz VanVan, erősNincs Taq polimerázVanVan/nincsVan

25 25 Templát független DNS polimeráz

26 26 RNS függő DNS polimeráz

27 27 DNS jelölés, nick transzláció

28 28 denaturálás N: A,C,G,T (NNNNNN) hibridizáció DNS polimeráz dNTP polimerizáció denaturálás Jelölt szálak DNS jelölés, random priming

29 29

30 30 DNS függő RNS polimerázok

31 31

32 32

33 33

34 34

35 35

36 36

37 37

38 38 Klónozás fogalma Egy általunk kiválasztott DNS darabot vektor segítségével gazdasejtbe juttatunk és ott felszaporítunk Szubklónozás: további kisebb darabok hasonló felszaporítása vektor Hasítás, A,B enzimekkel A A B B inszert ligálás Transzformálás, felszaporítás, tisztítás Vektor: olyan nukleinsav hordozó, amellyel nukleinsavakat sejtbe lehet juttatni, Felhasználás: klónozás, fehérje termeltetés, genetikai manipulációk stb. Hasítás, A,B enzimekkel

39 39

40 40 KÓNOZÁSBAN ÁLTALÁNOSAN HASZNÁLT VEKTORTÍPUSOK példa inszert méret plazmidokpUC18,19< kb fonalas fágokmp18, 19< kb fagemidekpBluescriptKS, SK±< kb fágokEMBL3,4 néhányszor 10 kb kozmidokpHC79 néhányszor 10 kb PLAZMIDOK replikációs origo ORI rezisztencia marker Cirkuláris kettősszálú extrakromoszómális elemek BAC, YAC néhány 100 kb pBAC108L, pYAC3 BAC, YAC: bacterial, yeast artificial chromosome

41 41

42 42 Egy ősi plazmid: pBR322

43 43 Magas kópiaszámú változat: pUC19

44 44 Inszertet tartalmazó klónok kiválasztása -antibiotikum rezisztencia, ld. pBR3222, két antibiotikum, az egyik elromlik, ha inszert épül be, fáradtságos szurkálások, két antibiotikum rezisztencia gén szükséges - kolónia hibridizáció, univerzális mindig használható - plazmid tisztítás, térképezés restrikciós emésztéssel hosszú fáradtságos - polimeráz láncreakció sejteken, kombinatorikus gyors ha nincs más szelekció - kék fehér színszelekció, - pozitív szelekciós vektorok, kondicionálisan letális gén a vektoron, az inszert beépül, elrontja a gént  megszűnik a letalitás - auxotrofiát komplementáló génbe történő klónozás ugyanaz a probléma, mint az antibiotikumok esetén

45 45 Kolónia hibridizáció

46 46 LacZ  komplementáció F' plazmidon: defektív  - galaktozidáz gén, hiányzik aminosav közötti régió bevitt vektor: tartalmazza a lacZ szabályozó régiót és az aminosavat a kettő együtt: aktív  – galaktozidáz  X-gal szubsztráttal kék telep a bevitt N-terminális fragmentben : polilinker régió (leolvasási keret marad) ebbe lehet klónozni fragmentumot, ha kis fragmentum és leolvasási keret nem romlik el  X-gal szubsztráttal kék telep, ha elromlik vagy nagy fragment  X-gal szubsztráttal fehér telep

47 47 PLAZMIDOK SEJTBE JUTTATÁSÁNAK MÓDJAI 1. Kémiai transzformálás Kompetens sejt: a DNS felvételére alkalmassá tett sejt A sejteket felnövesztés után centrifugáljuk speciális kétértékű kationokat (Ca2+, Mn2+) tartalmazó oldattal kezeljük, sejtfal permeabilitást növelő ágenst (DMSO) adunk hozzá transzformációs hatékonyság: transzformáns /µg DNS elvi szám a transzformációt£ 1 ng mennyiségű DNS-sel hajtjuk végre : normál érték: 10 6 – 10 8 nagyon jó: 10 9 a transzformáció hatékonyságát meghatározó tényezők: -oldatok edények tisztasága, - sejtek növekedési sebessége, a növesztés fázisa, hőmérséklete - hősokk hőmérséklete hossza - permeabilizáló faktor a lineáris DNS transzformációs gyakorisága kb 2 nagyságrenddel alacsonyabb, mint a cirkulárisé egyéb fogások: -spheroplast készítés ozmotikum jelenlétében és ezt transzformáljuk - a DNS-t liposzómába csomagoljuk transzfomálás előtt

48 48 Transzformálás hatékonyságát meghatározó tényezők II. plazmid mérete hősokk hőmérséklete, hossza permealizáló ágens tárolhatóság

49 49 Elektroporáció A sejteket felnövesztés után kis vezetőképességű, glicerines (nagy ellenállású  600  ) pufferben szuszpendáljuk nagy feszültségű impulzust adunk rá kb 5 ms-ig transzformációs hatékonység x jobb (10 10 /µg DNS) sejttípusonként optimalizálni kell maghatározó faktorok: - az oldat ellenállása - az impulzus nagysága, hossza - permeabilizáló, redox potenciált befolyásoló faktorok adagolása

50 50 KONJUGÁCIÓ Sejtből sejtbe történő DNS átadás lépései: párosodás: speciális kontaktus a donor és a recipiens között egy speciális sejtfelszíni ponton keresztül (pl. pilus) DNS átjuttatását közvetítő folyamatok, replikcáció (rolling circle, az egyik szál átjutása) konjugációs elemek donorból donort csinál az első ilyen a a szex faktor, F episzóma másik: IncP  csoportba tartozó: RP4, RK2 plazmidok (szilárd fázishoz mobilizálható plazmidok a recipiensből nem lesz donor a plazmid tartalmazza a DNS processzáló apparátust, oriT, mob régió tra gének, pilus: N-acetilált TraA

51 51 TraI Töréspont, nick 5’5’ TraI 5’5’ donorrecipiensdonorrecipiens TraI 5’5’ donorrecipiens Egyszálú DNS kötő fehérje TraC primáz RNS primer Replikatív DNS polimeráz A DNS transzfer mechanizmusa a konjugáció során

52 52 Mobilizálható vektorok Nem tartalmazzák a tra géneket, csak a transzferhez szükséges oriT-t tra gének: integrálva a kromoszómába, három komponensű konjugáció: sem a donor sejt sem a recipiens nem tartalmazza a transzferhez szükséges géneket, hanem egy harmadik sejt

53 53 Fonalas fágok I. M13, f1 és fd fágok, genomjuk 98%-ban azonos  rekombinálnak egymással Az érett fágok genomja egyszálú cirkuláris DNS, a sejten belül: RF, replikatív forma  ez alkalmas genetikai manipulációkra A fág genomjának 90%-a 10 fehérjét kódol, nagyobb intergenikus régió a VIII és a III gének illetve II és IV gének között, regulátor funkció A fág a szexpiluson keresztül fertőz, a DNS (+) szál jut be a sejtbe  ebből lesz kétszálú replikatív forma perc, kópia Nem öli meg a gazdasejtet, csak lassítja a növekedést VIII fehérje a fő strukúr protein, 2700 kópia, a III. számú fehérje a filament végén néhány kópiában Az RF forma képződése után transzkripció, transzláció, Replikáció: II fehérje töréspontot idéz elő, DNS polimeráz I polimerizál WC papír modell. a II. fehérje vagdossa egységnyi darabokra V. fehérje: egyszálú DNS kötő fehérje, represszálja a II gén expresszióját  kópiaszám kontroll

54 54

55 55 A fonalas fágok életciklusa

56 56 Egy fonalas fág térképe

57 57

58 58 Epitóp könyvtár készítése, fág display vektorok gVIII (vagy gIII) gén (NNN) x X : 6 vagy hosszabb

59 59 Egy példa: anthrax toxin inhibitor tervezése phage display technikával Az anthrax toxin érése, patogenezise, potenciális célpontok A (PA 63 ) heptamert felkötjük egy oszlopra

60 60 Egy példa: anthrax toxin inhibitor tervezése phage display technikával II. átfolyó specifikus felkötődik elúció DNS izolálás, szekvenálás (NNN) x A (PA 63 ) 7 oszlopon kromatografáljuk ACCTATTGGTGGCTGGAT TYWWLD

61 61 Fagemidek: fonalas fágok és plazmidok hibridjei

62 62 A fágok általános felépítése  genetikai anyag: kb duplaszálú lineáris DNS  fertőzéssel jut a sejtbe,  nagy hatékonyság  két életciklus: - lizogén: a fág genetikai anyaga beépül a kromoszómába, a sejt túlél - lítikus: érett fág képződése során a sejtek lizálnak elpusztulnak  a végeken ragadós. ún. ’cos’ végek bal kar 20 kb centrális régió 14 kb jobb kar 9 kb cos a középső, centrális régió eltávolítható EcoRI BamHI SalI EcoRI BamHI SalI cos

63 63

64 64 A lambda fág életciklusa

65 65

66 66 Lambda fág példák Helyettesítő/ replacement vektorok Inszerciós vektorok

67 67 A pakolódás feltétele, hogy a rekombináns gemon mérete a vad típus méretének 79 – 105 %- a lehet. A klónozás menete helyettesítő vektorok esetén

68 68 Génátvitel transzdukcióval baktériumokban fág DNS bakteriális DNS-t is tartalmazó többnyire defektív fágok intakt normál fágtranszdukáló fág bakteriális fágfertőzés lizogén életciklus fág genom integrálódása a baktérium kromoszómájába a fág által hordozott bakteriális DNS beépülése rekombinációval

69 69 Kozmidok: plazmidok és fágok hibridjei fertőzéssel bejuttatható plazmidok

70 70 GÉNEK ELŐÁLLÍTÁSÁNAK STRATÉGIÁI Gének izolálása A megfelelő organizmus génkészletéből a kívánt régiót tartalmazó szakasz valamilyen módon való kinyerése elterjedtebb, -általában gyorsabb, kevesebb munkát igényel (ha lehetséges) - nem feltétlenül szükséges szekvencia információ, de nem árt, ha van - a különböző organizmusok genom szekvenciái nagy segítséget jelenthetnek - hátrány: kodon preferencia adott, nem tervezhető Gének szintézise Szintetikus oligonukleotidokból történő összeépítés - kevésbé elterjedt - a gén hosszától függően sok munkát igényelhet, - a fehérje elsődleges szekvenciáját ismerni kell - előny: tervezhető a biológia szabályainak figyelembevételével, - az optimális kodon felhasználás a gazda sejthez igazítható, az optimális fehérje túltermeltetési tapasztalatok jobban kamatoztathatók

71 71 KÖNYVTÁRAK TÍPUSAI - genomiális a teljes genomból készül, elvileg minden információt tartalmaz (pl. nem transzlálódó régió, szabályozó régiók, intronok) mind prokariótákból, mind eukariótákból - cDNS az aktívan termelődő mRNS-ekből készül csak az érett mRNS szekvenciáját tartalmazza (nincs intron szabályozó régió stb) csak eukariótákból expressziós a cDNS-eket ún. expressziós kazettába klónozzuk, ezáltal a kódolt fehérje (ha a mRNS kódol ilyet) aktívan termelődhet Követelmények a könyvtárakkal szemben - fedje le a teljes genomot, illetve mRNS populációt - ne legyen redundáns

72 72 konkatamer in vitro pakolás: összekeverés fágfehérje extraktummal GENOMIÁLIS KÖNYVTÁR KÉSZÍTÉSÉNEK SÉMÁJA bal kar jobb kar bal karjobb kar centrális régió hasító helyek emésztés részleges vagy kb méretű teljes emésztés fragmentek ligálás A pakolódás feltétele, hogy a rekombináns gemon mérete a vad típus méretének 79 – 105 %- a lehet.

73 73 Bakteriális shot-gun könyvtár készítése kromoszómális DNS nebulizátor összetört DNS végek tompítása Preparatív gél elektroforézis 2-3,5 kb fragmentek defoszforilálás transzformáláselektroporálás E. coli

74 74 cDNS könyvtár A mRNS-ekkel szemben támasztott követelmények  Integritás  A mRNS mérete, degradált-e Megoldás: denaturáló gélelektroforézis (várt méret kb, a többség kb)  Lehet-e teljes hosszúságú cDNS-t szintetizáltatni Megoldás: elõzetes reverz transzkripció jelölt nukloetidokkal elektroforézis  Lehet-e nagy molekulasúlyú fehérjéket in vitro szintetizálni Megoldás: in vitro transzláció jelölt aminosavakkal  A kérdéseses fehérjét tudjuk-e szintetizáltatni Megoldás: in vitro transzláció + immunoprecipitáció

75 75  A kérdéses mRNS előfordulási gyakorisága különböző mRNS emlős sejtekben  nagy gyakoriságú %, pl. globin nem problematikus  kis gyakoriságú  0.5 % nagy könyvtárat kell készíteni, és a detektálás is gond N = ln(1-P) / ln(1-1/n) N: a szükséges klónok száma a könyvtárban, P: annak a valószínûsége, hogy a keresett klón benne legyen a könyvtárban, 1/n: az a mRNS frakció, ami 1 db keresett mRNS-t tartalmaz immunoprecipitált in vitro transzlált termék/ összes transzlált termék pl. 14 molekula/sejt,  1/n = 37000, P= 0.99, N= A cDNS könyvtár mérete

76 76 cDNS-könyvtár készítése primer adapter módszerrel

77 77 cDNS-könyvtár készítése

78 78 Szubsztraktív hibridizáció AAAAAAAAA 3' 5' TTTTTTTTT biotin reverz transzkripció B B B RnázH immobilizált streptavidin SA B B B cDNS könyvtár csak indukált mRNS átfolyó cDNS, jelölés hibridizáció nem indukált minta, mRNS tisztításindukált minta, mRNS tisztítás

79 79 EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról RENDELKEZÉSRE ÁLLÓ VAGY SZÜKSÉGES INFORMÁCIÓK A KERESETT FEHÉRJÉRŐL, ILLETVE GÉNJÉRŐL - nem tudunk semmit csak fenotípus alapján jellemezhető mutagenezis (transzpozon) kromoszomális séta van tisztított fehérje fehérje funkció tesztelhető expressziós könyvtárak fehérje szekvenálás  DNS próba tervezés ellenanyag termeltetés expressziós könyvtárak már van ilyen fehérje illetve gén más típusú sejtekből heterológ próba használata könyvtárak átvizsgálásához

80 80 kolónia vagy plakkhibridizáció, jelölt DNS-sel DNS próba előállítása: - szintetikus (degenerált) oligonukleotidok - megfelelően választott primerekkel elôállított PCR fragment - izolált DNS fragment (lehet heterológ is) Jelölési módszerek - radioaktív vagy nemradioaktív - 5' foszforilálás, vagy 3' végen feltöltéses végjelölés vagy terminális transzferázzal, "nick-transzláció", "random priming", PCR POZITÍV KLÓNOK KÜLÖNBÖZŐ KÖNYVTÁRAKBÓL VALÓ KIVÁLASZTÁSÁRA SZOLGÁLÓ MÓDSZEREK honnan lehet próbánk: >a gén már ismert, legalábbis egy darabon > heterológ próba: más mikroorganizmusokból már ismert hasonló géne > van tiszított fehérjénk  fehérje szekvenálás  DNS próba tervezés reverz transzlációval

81 81

82 82 [gbbct]: 50 CDS's (13879 codons) Egy példa AmAcid Codon Number /1000 Fraction Gly GGG Gly GGA Gly GGT Gly GGC Glu GAG Glu GAA Asp GAT Asp GAC Val GTG Val GTA Val GTT Val GTC Ala GCG Ala GCA Ala GCT Ala GCC Arg AGG Arg AGA Ser AGT Ser AGC Lys AAG Lys AAA Asn AAT Asn AAC Met ATG Ile ATA Ile ATT Ile ATC Thr ACG Thr ACA Thr ACT Thr A CC Trp TGG End TGA Cys TGT Cys TGC End TAG End TAA Tyr TAT Tyr TAC Leu TTG Leu TTA Phe TTT Phe TTC Ser TCG Kodon felhasználási preferencia – táblázat

83 83 - Immunológiai detektálás poli- vagy monoklonális ellenanyaggal - Aktivitás mérés (csak bizonyos szerencsés esetekben) - Valamilyen módon jelölt liganddal (ha van a keresett fehérjének) cDNS-ből készült expressziós könyvtárból

84 84 ÉLESZTŐ KÉT HIBRID RENDSZER fehérje-fehérje kölcsönhatáson alapuló szelekció GAL4 transzkripciós aktivátor aktivátor régió (AR)DNS kötő domén (DKD) lacZGAL4 kötő hely DKD Protein X Protein Y AR lacZGAL4 kötő hely DKD Protein X AR Protein Y kölcsönhatás esetén: kék telepek

85 85 BAKTERIÁLIS KÉT HIBRID RENDSZER lacZGAL4 kötő hely DKD Protein X Protein Y RNS pol. pozitív szelekció, nagyobb könyvtárakra GAL4 kötő hely his3 DKD Protein X RNS pol Protein Y lacZ DKD Protein X RNS pol Protein Y GAL4 kötő hely kölcsönhatás esetén: kék telepek kölcsönhatás esetén: növekedés hisztidin mentes táptalajon

86 86 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

87 87 RESTRIKCIÓS TÉRKÉPEZÉS

88 88 vektor Hasítás, A,B enzimekkel A B A B inszert ligálás Transzformálás, felszaporítás, tisztítás Hasítás, A,B enzimekkel AB A C Klónozás, szubklónozás

89 89 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

90 90 AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA

91 91 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

92 92 De ha sikerül, és van szekvenciánk Mi van rajta,van-e gén? Honnan tudjuk, hogy Valamit találtunk, találtunk-e gént? CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGA TCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGG TCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTT CGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAG GGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGC CGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGT CCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCA TTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCG AGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC GGGAATGCTTCGTGTTGAAGTGGCCCTGGCGCGCGCGCAGGCGGCAGAGGGCCTTGTCAGTTCGGAATTGGCCGACGCGATCGAGGTTGTTGGTACTGCCGGGTTGGACCCCGAGGCGAT GGCGGCGACTACTCGCATGACAGGAGTGCCCGCAATATCGTTCGTCCGTGCGGTGCAATCGGCCCTGCCGCCCTCACTGGCGGGTGGATTTCATTTCGGCGCCACCAGTCAAGACATCGT GGATACGGCCCACGCGCTCCAGCTGGCCGAGGCACTCGATATTATAGAAGTCGATTTACACGCCACTGTCAGCGCAATGATGAATCTGGCCGCTGCTCACTGCAATACACCCTGTATCGG GCGCACGGCCTTGCAGCACGCAGCGCCAGTTACGTTCGGCTACAAGGCGTCCGGCTGGTGCGTTGCCCTGGCGGAGCATCTGGTGCAGCTTCCCGCGCTGCGAAAGCGGGTTCTGGTGGC GTCGCTAGGGGGGCCGGTTGGTACCCTTGCCGCGATGGAGGAGCGGGCCGACGCTGTACTGGAGGGTTTCGCTGCGGACCTGGGGTTGGCCATTCCCGCCCTGGCCTGGCACACGCAGCG GGCCCGGATCGTCGAGGTGGCCAGTTGGCTGGCCATATTGCTGGGAATTCTGGCAAAAATGGCCACCGATGTCGTTCACTTGTCCTCCACGGAAGTGCGCGAGCTTTCCGAACCTGTAGC GCCGGGCAGGGGGGGCTCCTCGGCGATGCCTCACAAGCGGAACCCGATTTCCTCGATTACCATCCTGTCCCAGCATGCTGCGGCAGGGGCCCAGCTCTCCATTCTCGTGAACGGCATGGC CAGTCTGCACGAACGTCCGGTGGGGGCGTGGCATTCGGAATGGTTGGCTCTGCCGACGCTGTTCGGCCTTGCCGGCGGTGCCGTGCGCGAGGGCAGGTTTCTGGCCGAGGGGCTGCTGGT CGATGCCGACCAGATGGGTCGCAATCTACAATTGACCAATGGCCTGATTTTCAGCGACGCGGTAGCCGGCCAGTTGGCAAAGCACTTGGGTCGGGCCGAGGCTTATGCCGCTGTCGAGGA TGCCGCCGCCGAGGTGTTGCGTTCAGGCGGCAGCTTTCAGGGTCAGCTGAACCAGCGCCTGCCCGATCACCGCGACGCTATCGCTATTGCTTTTGATACGACGCCGGCGATCCAGGCCGG GGCCGCCCGCTGCCGTAGTGCGCTGGATCATGTGGCTCGTATTCTTGGACCCGCCTCTACCATCGGATTTCAAGGAGGCTAATGACGTGACGACACTGTTTGAGGCGACGACCATCCCGA TTTGCGAGGGCCCGCGCGACCAGACCGCCGAGATCCTTTTCGAGATGCCGCCGGGTGCGTGGGATACCCATTTTCATGTTTTTGGCCCAGTTTCATCGTTTCCATACGCAGAACACAGGC TCTATTCCCCACCGGAGTCGCCACTTGAGGATTATCTGGTGTTGATGGAGGCTTTGGGGATCGAGCGCGGCGTTTGTGTCCATCCGAATGTTCATGGTGCCGACAATTCGGTGACGCTCG ACGCAGTTGCGCGGTCCGATGGTCGTCTGCTGGCGGTGATCAAGCCACATCACGAGATGACTTTTGTTCAGCTGCGGGACATGAAGGCGCAGGGGGTCTGCGGGGTACGTTTTGCCTTCA ATCCGCAGCATGGCTCGGGCGAGTTGGATACTCGTTTGTTCGAGCGTATGTTGGACTGGTGCCGCGACCTAGGCTGGTGCGTAAAATTGCATTTCGCGCCCGCTGCGCTGGACGGTCTGG CTGAACGTTTGGCGCGCGTCGATATTCCGATCATCATCGATCATTTCGGGCGGGTGGACACCGCGCAAGGTGTGGATCAGCCGCACTTCCTGCGTTTGCTCGATCTGGCCAAACTGGACC ATGTCTGGATCAAGCTTACGGGGGCAGATCGTATTAGCGGTTCCGGCGCGCCATATGACGATGTCGTGCCCTTCGCGCACGCTTTGGCAGATGTGGCGCCCGACCGCCTCCTCTGGGGTT CGGATTGGCCGCATTCAGGCTATTTCGATCCGAAGCACATACCCAATGACGGCGACTTGTTGAACCTTTTGGCGCGTTTTGCCCCCGATGCTGAACTGCGTCGTAAGATCCTTGTGGACA ACCCGCAGCGCCTGTTCGGGGCTGCTTGAGGAGCCGAGCCGATGCAACCTTTCGTCTACGAAACAGCCCCAGCGCGCGTCGTTTTCGGGCGCGGCACTTCGCAGAATCTGCGGCGGGAAC TTGAGGCCCTGAATTTTGGCAGGGCGCTGGTTCTTTCCACGCCCGACCAAAAAGAACAATCGCTGCGAATTGCCCAGGGCCTGGGTTCTCAGCTGGCGGGGTCGTTCCACGCCGCTGCCA TGCATACGCCTGTCGAGGTCACCTTGCAGGCGCTTGAGGTGCTGAAGGATGTGCAGGCCGATTGCATCGTGGCGATTGGCGGCGGCTCAACCATTGGGTTGGGCAAGGCACTGGCCCTGC GCACCGATCTGCCGCAGATCGTCGTCCCGACGACTTATGCCGGCTCGGAAATGACGCCGATCCTGGGAGAGACGGAAAACGGGCTGAAGACCACACAGCGTAATCCCAAAGTGCAGCCGA GGGTGGTTCTCTACGATGTGGACCTGACTGTGACGCTTCCGGTGCAGGCCTCGGTTACATCAGGCATGAATGCGATCGCCCATGCGGCCGAGGCATTATATGCGCGGGACGGCAATCCGG TGATCTCGCTGATGGCCGAAGAGGCGATCCGCGCGCTGGCCCATGCCCTGCCGCGTATCGTTGCCACTCCCGACGATATCGAAGCGCGCAGCGATGCCCTCTATGGCGCGTGGCTGTGCG GAACGTGCCTGGGTTCGGCCGGAATGGCGTTGCACCATAAGCTCTGCCACACCCTCGGCGGAAGTTTCGATTTGCCACATGCCCCGACCCACACGGTCATCCTCCCCTATGCGCTCGCCT ATAATAGTGATGCGGCCAGGCCCGCAATGGCAGCCATCGCGCGCGCGCTGGGCATGGCGGATGCAGCGATGGGCATGAGAGCGTTGTCCATGCGGTTGGGCGCCCCGACATCGCTGCGTG AGTTGGGCATGGCAGAAGCCGATCTTGACCGCGCCGCCGACCTGGCCACGCAAAATGCCTATTGGAACCCGCGACCCATCGAGCATGGGCCGATTCGTAACCTTCTGGGACGGGCCTGGG CTGGAACTCCGGTCTGAAGGACCTAGAGGACAGTCAATTCATTGATCTGAAGTCACCAACGAGGAGATATGGGATGAACGAGAACATTGCGATCCGCAAATTGGGCCGCCGACTCCGATT GGGCATTGCCGGTGGCGCGGGTCATTCGCTGATTGGTCCGGTTCACCGGGAGGCGGCTCGGCTTGACGATTTGTTCTCTCTCGATGCTGCGGTGCTGTCCAGTAACGCGGAACGCGGGGA TGCTGAGGCCGCGGCTCTCGGAATTCCGCGCTCCTATTCGTCCACCGCCGAGATGTTCGCAATGGAGAAGGCTAGGCCCGACGGTATTGAGGCCGTTGCCATAGCCACGCCGAATGACAG CCATTACCGGATTCTGTGCGAGGCGCTGGACGCCGGGTTGCATGTAATCTGCGACAAGCCTTTAACCTCCACGAAGGCCGAGGCCGACGACGTGCTGGTGCGGGCGAAGGCCGCGGGCAA GGTTGTGGTCCTGACCCACAATTATTCTGGCTACGCCATGGTACGCCAAGCCCGCGCCATGGTCGCCGCCGGTGAACTTGGGAAAATCCACCAGATTCACGGGGTCTACGCTCTGGGCCA GATGGGCCGTTTGTTCGAGGCCGACGAAGGGGGCGTGCCTCCGGGGATGCGTTGGCGGATTGATCCTGCGCGCGGTGGCGACAGTCACGCCCTGGTGGATATCGGCACCCATGTGCACCA TCTGGCTACCTTCATCACGCAGTTACAGGTCGTTGAGGTAATGGCCGATCTTGGGCCGGCGGTTCAAGGCCGCGCGGCCCATGACAGTGCCAACGTCATGTTCCGTATGGAAAACGGAGC TTTCGGATCGTTCTGGGCCACCAAGGCGGCATCGGGGGCCAGCAAGCTGGCGATCGAAGTCTACGGTGACAAGGGCGGCGTCCTGTGGGAGCAGGCCGACGCCAATAACTTGCTACATAT GCGGCAGGGCCAACCCCCAGCCCTGATTGGTCGACAAGTTGCCGGGCTGCATCCTGCGGCAATCCGCGCGATGCGGGGGCCGGGTTATCATTTCGTGGAAGGCTATCGCGAGGCCTTTGC GAATATGTACGTGGATTTCGCCGAACAGATCTTGGCCATGATGGGCAAGGGGGCCGCAGATCACCTGGCATTGGAAGCGCCGTCGGTCGTGGACGGCCTGCGCTCCATGGCGTTCATCGA AGCCTGTGTGGCGTCGTCGCAGGACCGCCAATGGCGGCAGGTGGAGCAAGTCAGTTGATCTCTCAGCGGCTTCGGCATTTTTCCCGGGCTGGCGGCTCCCCGCAGCTCCCTCCGGTGGAA AGAACGGGTAATCAAAATAATATTCTGATTTTAAAGGATGTTCCAGACAGCTGATTATTCCTGAAATTTAGGGCTCTTTCGGCTGTAGCAATTGACTAAAAGCCGAATTTAAGGGTAA TTAAACAAACGCTGTTCGTATTATTTAAACAGGTGAGTGATGGCGATATTCCTGGAAGGCTGGCCGATGGTTTCATCTGAATACCCGGCCAGAAGCGTTGAGGCGCACCCGGCCTATCTG AC GCCAGACTATGTTTTCACGCGAAAGCGTGCGCCGACTCGACCGCTGCGGTTAATTCCTCAGTCTGCGACGGAGCTGTATGGCCCGGTTTATGGACAAGAGAGCGTCCGTCCGGGGGATAA CGACCTGACCCGTCAGCACGAAGCTGAGCCGGTGGGGGAGCGGATTCTGGTGACGGGGCGCGTGACCGACGAAGACGGGCGGGGTGTCCCTAATACGCTGCTAGAGATCTGGCAGGCCAA TGCCGCCGGTCGCTATATCCACAAGCTTGACCAGCATCTTGCCCCGCTTGATCCAAATTTCTCGGGGGCAGGGCGTACGGTTACGGGGGCTGATGGCTCTTATTCCTTCATCACGATCGT GCCGGGCGCCTATCCGGTCGTGGGGCTGCACAATGTCTGGCGCCCGCGCCACATCCATGTGTCGTTGTTCGGTCCGTCCTTCGTGACCCGCTTGGTTACCCAGATATATTTCGAGGGCGA TCCGCTGCTGAAATATGACACGATCTACAACACGGCGCCCGACATCTCGAAGCGCAGCATGGTGGCGCAGTTGGACATGGGCGCCACGCAATCCGAATGGGGCCTGACCTATCGCTTCGA CATCGTTCTGCGTGGGCGCAACGGCAGCTATTTCGAGGAACCCCATGACCACTAAGACCCCACTGACCATCACCCCCTCGCAGACTGTCGGGCCTTTCTATGCCTATTGCCTGACCCCGG AGGACTACGGGACGCTTCCACCGCTGTTCGGCGCGCAGCTTGCGACCGAGGACGCCGAAGGGGAACGGATTACGATCCAGGGAACGATCACGGACGGAGAGGGGGCCATGGTTCCCGATG CCTTGATCGAGATCTGGCAGCCGGACGGGCAGGGGCGTTTTGCTGGAGCCCATCCAGAGCTGCGGAATTCGGCCTTCAAGGGCTTCGGGCGCCGCCACTGTGACAAAAGCGGAAACTTCA GTTTCCAAACCGTGAAGCCTGGCCGGGTGCCCACTGCCGACGGCGTGATGCAGGCACCCCATATCGCTTTGTCGATCTTCGGCAAGGGATTGAACCGCCGGCTCTATACGCGGATCTACT TCGCAGACGAGGCATCGAATGCCGAGGACCCCGTTCTGTCGATGCTGTCCGAGGATGAGCGCGTGACCCTGATCGCCACCTCTGAATCGCCCGCCGCATATCGCCTCGACATCCGCCTGC AAGGCGACGGCGAAACGGTGTTTTTCGAGGCCTGAGTCGGCCGGCAAGTTTGCGGGGATCCGTCCGCCGCAATTGTGTTTCGCTATAGACGCCACGGCTGCCGCATGCCGCCGGGTGGAA GGGCCTTGCAAGGCCTGTCAACGGCGGAGTAAAATCCGGCCAGGCGGCGGAGTAAAACCAGGCCACTTGTGGCCCACGCATGAGACACCCGGGAGGGCGTAGCCCAAGCGGGGGTCTCAT GCGTGTGCGGCGGTTTTCTGGGGGTTCAGCCAGCCTTGCGGGCGCGGCTTTGAGCGAGACGATAGCTGTCGCCGTTCATCTCGAG

93 93 1. DNS szekvencia homológia alapján Adatbankok, FASTA, BLAST 2. ORF KERESÉS, Általában ATG-vel kezdődő szakaszokat keresünk, amelyek ésszerűen hosszúak (100 aminosav) Clone ManagerClone Manager 3. A kapott ORF-k homológia kutatása Adatbankok, FASTA, BLAST HONNAN LEHET TUDNI, HOGY GÉNT TALÁLTUNK?


Letölteni ppt "1 A Biotechnológiai Tanszék oktatási anyaga az alábbi internet címen érhető el:"

Hasonló előadás


Google Hirdetések