Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Rekombináns fehérjék előállítása bakteriális expressziós rendszerben.

Hasonló előadás


Az előadások a következő témára: "Rekombináns fehérjék előállítása bakteriális expressziós rendszerben."— Előadás másolata:

1 Rekombináns fehérjék előállítása bakteriális expressziós rendszerben

2 In vivo expressziós rendszerek Prokarióta  E. coli: széles körben alkalmazott, egyszerűen kontrollálható, magas hozam, nem lehetséges a transzláció utáni módosítás, aktivitás elveszhet, endotoxinok  S. aureus: a termelődő fehérje a tápoldatba szekretálódik, nem magas a hozam Eukarióta  Élesztő: kevés az endogén eredetű fehérjetermelődés, fermentáció olcsó, glikoziláció és diszulfidhidak kialakulhatnak, bonyolult kontrollálhatóság, a glikoziláció nem az emlős sejtes  Rovarsejtek /Bakulovírus/: poszttranszlációs módosítások, magas hozam, biztonságos, az aktivitás nem mindig lesz meg  Emlős sejtek: nagy mennyiségben alkalmazható, sejtek kezelése nehezebb, kis hozam  Gomba: fermentáció jól kivitelezhető, biztonságos, kis hozam, klónozó vektorok hiánya

3 E. coli expressziós rendszer Az Escherichia coli (E. coli)  1885: Theodor Escherich  Pálcika alakú, 2 μm hosszú és 0,5 μm átmérőjű Gram-negatív baktérium  Peritrich csillós, lehet csillótlan (atrich)  Tokja általában nincs, de lehet tokos.  Aerob, fakultatív anaerob  Könnyen és jól tenyészthető  A veszélytelen törzsek a melegvérű állatok emésztőrendszerének normális flórájához tartoznak  Főként cukorral és bizonyos aminosavakkal táplálkozik.

4 Centrális dogma DNS RNS Fehérje Replikáció Transzkripció Transzláció In Vivo fehérje expresszió: E. coli mint expressziós rendszer Mire van szükségünk? E. Coli Expresszálandó fehérjét kódoló cDNS Erről át is tudjon íródni Nagy mennyiségben keletkezzen a célfehérje Célfehérjét könnyen el tudjuk különíteni a sejt többi fehérjéjétől

5  Kétszálú cirkuláris extrakromoszomális DNS, főleg bakteriális szervezetekben elterjedt. → csupasz vírusok, ma ezeket a molekulákat sem tartjuk élőlénynek.  Méretük kbp. A sejten belül kópiaszámban léteznek.  A szekvenciájában lévő replikációs origónak köszönhetően a sejtben osztódva generációról generációra fennmarad.  Sejtről sejtre a konjugációnak nevezett folyamat során terjednek.  Interspecifikus terjedés! Horizontális géntranszfer Plazmidok  A sejt védekezik az idegen DNS terjedése ellen: enzimek ismerik fel a „betolakodó” DNS-t, és feldarabolva hatástalanítja Plazmidok géntechnológiai felhasználása:  Meghatározott DNS darabot beleintegrálva képesek vagyunk felszaporítani (klónozó vektor)  Ha a plazmid lehetővé teszi, akkor a DNS-ről fehérjét is termelhetünk (expressziós vektor) A plazmidokat a génjeik funkciója szerint szokták csoportosítani: R-plazmidok (Rezisztencia plazmidok): antibiotikumok elleni védelmet biztosít. Laborban leggyakrabban használt plzmidok Amp, Kan, Tet, Chl. Col-plazmidok: A többi sejtre mérgező, de a plazmidot tartalmazó sejt számára ártalmatlan anyag terelése (kolicin) F-plazmidok: fertilitási plazmidok, pilus növesztésével, lehetővé teszi, hogy érintkező sejtek között génkicserélődés történjen. Degradatív plazmid: új anyagcsereutat lehetővé tevő gének, így a sejt képes lesz új táplálékforráson megélni. Virulencia plazmid: hatására a sejt patogenné válik → új táplálékforrás nyílik meg előtte!

6 Expressziós vektorok: Speciális genetikai környezet, mely lehetővé teszi, hogy a beépített DNS-ről fehérje íródjon át A konstrukció tervezésénél fontos, hogy az inszert a megfelelő leolvasási keretben épüljön be, különben a fehérje szekvenciája nem lesz megfelelő!! Promoter Operátor régió Riboszóma kötőhely Transzlációs transzkripció klónozó starthely terminációs hely hely Expressziós vektorok

7 A 3. ciklustól kezdve a megjelenik az a DNS fragmentum, amit a reakcióhoz adott két primer határol. A következő ciklusban 8db (*-gal jelölt) ugyanilyen szekvencia szintetizálódik! Az 5. ciklusban pedig 64! A tipikus PCR reakció 30 ciklusának végeztére elméletileg 2 27 db keletkezik! (limitálja: polimeráz mennyisége/denaturációja, dNTP) A „nemkívánatos” termékek mennyisége csak lineárisan, míg az amplifikálni kívánt termék mennyisége exponenciálisan nő! 5’ 3’ * * * * * * * * PCR Mitől lesz ez a rendszer alkalmas arra, hogy a DNS egy meghatározott darabját amplifikálja? Mitől lesz ez lánc reakció? Polimeráz lánc reakció: A DNS molekula egy meghatározott darabjának felszaporítására alkalmas módszer. Kihasználjuk, hogy a DNS polimerizációja nem de novo folyamat, az iniciációhoz primer szükséges!

8 NdeI KpnI PCR 5’ plazm...ca tatg...insz... g gtacc...plazm 3’ 3’ plazm...gtat ac...insz... ccatg g...plazm 5’ Ligáz Restrikciós endonukleázok  A sejt védekezik az idegen DNS terjedése ellen: enzimek ismerik fel a „betolakodó” DNS-t, és feldarabolva hatástalanítja → meghatározott szekvencia után következik be a hasítás.  Ragadós vagy tompa véget eredményez a hasítás. → a PCR-rel felszaporított DNS szakasz meghatározott helyre, meghatározott orientációban beépíthető! Géntechnológiai felhasználás:  Olyan megszekvenált plazmidokat használunk, melyekben jól meghatározott helyeken meghatározott restrikciós felismerő helyeket tartalmaznak. (multi cloning site)  A PCR reakciót olyan oligonukleotidokkal végezzük, melyek restrikciós felismerőhelyeket hordoznak → beépül a végtermékbe! Ha felismer 6bp-s szakaszt, akkor valószínűsége: 4 6 -on, azaz 4096bp- onként fordul elő egy ilyen szekvencia. A coli genom: bp → ~1000 hasítóhely: meg kell védeni a saját genomot! Védelem: metilázok → a DNS metilálása meghatározott helyeken, gátolja a nukleáz felismerését, vagy a DNS kötését!

9 DNS konstrukció előállításának sémája Transzformálás DH5a sejtekbe Telepscreen Pozitív telepekről miniprep Tisztítás Agaróz gélelektroforézis Miniprepscreen Szekvenálás Primerek + Templát PCR reakció Agaróz gélelektroforézis Tisztítás Emésztés Agaróz gélelektroforézis Tisztítás Emésztés / Felnyitás Gélből izolálás Vektor Ligálás

10 1) A vektorban T7 promóter talalható, amihez csak a T7 RNS polimeráz tud kapcsolodni, aminek a génje az E. coil genomba van integrálva egy LacI operátor mögé (DE3). 2) Lac represszor gátolja az átírást, mind a vektoron, mind a T7 polimeráz gén előtt. 3) IPTG-vel történő indukció során a represszor leválik, így lehetővé téve a T7 polimeráz termelését, ami aztán az inszert gén átírását végzi. 4) A pLysS vektorról átíródó T7 lizozim amellett, hogy a sejtek feltárását segíti a sejtfal bontása altal, kötődik, az indukció előtt kis mértékben termelődő T7 polimerázhoz, inaktiválja azt, igy növelve az indukció specifikusságát. Expressziós vektorok Speciális genetikai környezet, mely lehetővé teszi, hogy a beépített DNS-ről fehérje íródjon át. A nem kívánt expresszió elnyomjuk, majd a megfelelő pillanatban (megfelelő sejtszám) indukáljuk → indukálható promoterek Lac promoter mögé helyezett gének csendesek, amíg a laktóz, vagy laktóz analóg IPTG nincs a közegben.

11 TC5b esettanulmánya A TC5b egy 20 aminosavas minifehérje, azaz RÖVID  „Közvetlen” expresszálás esetén  konformációs problémák miatt a sejt proteázai feltehetőleg megemésztenék  Tiszítási problémák  Fúziós partnerrel történő expresszálás esetén  Ez azt jelenti, hogy egy másik fehérjével kovalens kapcsolatban lenne a TC5b – GST, MBP, TrxA  Hasítási problémák  Thrombin, EnterokinázA, Xa faktor, TEV  Aminosavakat hagynának az N- vagy a C-terminálison  Drágák(kivéve TEV)  Méretproblémák: kitermelési hatékonyság romlik Az Ubikvitin fúziós expressziós rendszer jelent megoldást:  76 aminosav + linker + HIS6 (11 kDa)  Ubikvitin hidroláz  Termeltethető E. coliban  Specifikus, nem igényel a hasítási hely kialakítását  Nem hagy aminosavat

12 A mi ubiquitines vektorunk, amelyet a Zerbe-éktől kaptunk:  pET-19B alapú  Kanamycin rezisztencia  Bele lett építve az ubiquitin és a dekahisztidin-tag Ebbe kell beépítenünk a célfehérjét kódoló DNS szakaszt, ahogyan a képen látható az ubiquitin és egy BamHI hely közé (előbbi nem látható) TC5b esettanulmánya

13 Tehát a megrendelendő két oligó (azaz oligonukleotid): 5’ vég: AATCTGTATATTCAGTGGTTAAAAGATGGCGGTCC 3’ vég: ACTCGGCGGTGGACGCCCA GAGCTAGGACCGCCATC nevehelyeSzekvencia 5’ N257AATCTGTATATTCAGTGGTTAAAAGATGGCGGTCC 3’ N258+stop+BamHIaa ggatcc tta ACTCGGCGGTGGACGCCCA GAGCTAGGACCGCCATC Hogyan illesztjük be a vektorba? Ha megfigyeljük a klónozó szakasz ábráját, látható, hogy az ubiquitin és a TC5b között nincsen tag, vagyis az ubiquitin utolsó aminosava után a TC5b első aminosava következik vagyis az ubiquitin és a TC5b egymáshoz illesztendő vége tompa vég! Hogy csinálunk tompa véget? 1. Inszertoldalról oligorendeléssel 2. Vektoroldalról Mung Bean nukleázzal

14 TC5b esettanulmánya 1.A két oligonukleotid által meghatározott DNS darabot PCR segítségével amplifikáljuk 2.A TC5b cDNS-t BamHI restrikciós endonukleázzal emésztjók 3.Felnyitjuk a pUBK vektort: NsiI, Mung Bean endonukleáz, BamHI 4.A cDNS-t és a vektort „össze”ligáljuk 5.A ligátumot DH5a sejtekbe transzformáljuk 6.A felnövő telepeket inszertspecifikus oligonukleotidokkal screeneljük 7.A pozitív telepeket (klónokat) elszaporítjuk, és kinyejük belőlük a pUBK-TC5b vektort 8.Szekvenálás

15 A fehérjemunka Az expressziós vektor transzformálása BL-21 sejtekbe Egy telepről folyadékkultúra indítása Nagyexpresszió Stock készítés Táptalaj: jelöletlen v. jelölt Sejtek elszaporítása, majd indukálás Sejtek megsemmisítéseCélfehérje tisztításaMS

16 Nagyexpresszió: Vektortól a kultúra indításáig 1.A megfelelő expressziós vektor transzformálása kompetens BL-21 sejtekbe 2.Egy (!) telepről kis folyadékkultúra indítása (3-5 ml  Telep =! Sejt  Monoklonalitás fontossága 3.A kis folyadékkultúrából indítjuk a nagyexpressziót (liter) Táptalaj Jelöletlen fehérjék termelésére: LB, 2YT Összetétele ismeretlen: darált élesztő, emésztett fehérjék, só Jelölt fehérjék termelésére: M9 minimál Összetétele ismert: MgSO4, CaCL2, Na2HPO4, KH2PO4, NaCl NH4Cl, Glükóz Antibiotikum Nyomelemmix

17 Sejtek növesztése és indukálása 1. Sejtek növesztése E. Coli optimális növekedési hőmérséklete 37C Rázatás ( rpm) Megfelelő edény Erlenmeyer lombik vs. Fernbach flaska Térfogati szabály: (edényméret)/5=táptalaj mennyisége Sejtek növekedésének (szaporodásának) követése OD600 (1OD ~10^9 baktérium) MacFarrland (MF): 1MF=0,23 OD600 Megfelelő denzitás elérésekor indukáljuk a sejteket Sejtek indukálása Megfelelő denzitás elérésekor – ökölszabály: OD600=0,8 (MF=3,2) Indukálószer: IPTG Nagyexpresszió indítása előtt ki kell tesztelni Indukálószer koncentrációját (mM) Indukálás hőmérsékletét (10-37) és időtartamát (3-24)

18 Sejtek növesztése és indukálása 2. Nagyexpresszió vége = Indukálás vége  Lecentrifugáljuk a sejteket (10-15 perc, rpm)  Meggyőződünk arról, hogy a sejtek termeltek a fehérjét: SDS-PAGE  Mivel a sejtekben van a fehérje, ezért azokat ki kell nyerni – fel kell őket tárni  Homogenizációs (extrakciós) pufferben: ionerő, pH, redukálószer, nehézfém-kelátor  Célfehérje védése  Proteáz inhibitor  A műveleteket jégen végezzük  Módszerek 1. Enzimatikusan: Lizozim: glikánhidroláz (muramidáz), hidrolizálja a peptidoglükán murein komponensének 1,4b glikozidos kötéseit (N-acetil- glüköz-amin és N-acetilmuraminsav) Streptomycin szulfát (30%): aminocsoportjai kötnek a foszfát-csoportokhoz, azaz a DNS-hez és foszfolipidekhez, ezáltal azok aggregálódnak DNase 2. Mechanikai: Fagyasztás, Frech pump, Ultrahangos roncsoló (szonikátor) 3. Kémiailag: NaOH, MetOH, detergensek

19 A célfehérje izolálása Feltárás után centrifugálással elkülönítjük a szolubilis frakciót a csapadéktól 20 perc, rpm Mindkét frakcióból mintát veszünk, és SDS-PAGE-t végzünk velük Fő kérdés, hogy melyik fázisban van a célfehérje, meghatározza a későbbitisztítási lépések folyamatát: Szolubilis fázis: Tisztítás natív körülmények között Csapadék fázis: A fehérje inklúziós testekbe (IBS) került, tisztítás denaturáló körülmények között, refoldálási lépés szükséges Célfehérje izolálását a sejt többi fehérjéjétől nagyban meghatározza az expressziós vektor felépítése, illetve hogy melyik fázisba „került”

20 (Gél)elektroforézis Különböző fehérjék adott pH-n más-más töltéssel rendelkeznek. Vizes oldatban, elektromos erőtér hatására vándorlásra késztethetőek. Eltérő relatív töltésük miatt különböző sebességgel mozognak, azaz elválaszthatók egymástól. Elválasztás történhet: relatív töltés, méret, izoelektromos potn alapján

21 Poliakrilamid-Gélelektroforézis Akrilamid: katalizátor és iniciátor hatására gyökös polimerizációra képes, ezáltal nagy mólsúlyú lineáris polimer jön létre  Hidrofil, kémiailag inert és stabil  Neutrális (töltésektől mentes)  Fizikailag ellenálló  Áttetsző Megfelelő keresztkötő ágens hatására térhálós szerkezetet hozhatunk létre. A koncentráció révén a pórusméret szabályozható: molekulaszűrőt hozhatunk létre PoliAkrilmaid GélElektroforézis: Nagy felbontóképesség, szeparálás relatív töltés, méret és alak alapján

22 Poliakrilamid-Gélelektroforézis A gél elkészítése  Akrilamid : biszakrilamid oldat – pórusméret!  Megfelelő pH-jú pufferoldat  Katalizátor (Ammónium-Peroxidiszulfát) és Iniciátor (TEtraMetilEtilén-Diamin)  Az APS vizes közegben spontán bomlik, szabad gyökök keletkeznek. Ezek azonban nem képesek az akrilamid kettős kötését felhasítva elindítani annak gyökös polimerizációját. Viszont gerjeszti a TEMED-et, melyből ekkor szabad gyökök alakulnak ki – ezek indítják el a polimerizációt  Kialakítás: üvegampullák vagy két üveglap közé A gélelektroforézis sikerét két dolog befolyásolja  Akrilamid koncentráció  pH helyes megválasztása  Fehérjék esetében a pI-nél mgasabb pH-n dolgozunk, így a fehérje negatív töltésű, az anód fele vándorol  Puffer  Állandó pH-t biztosít  Ionjai végzik az áramvezetést: A fehérjék minimálisan vesznek ebben részt – ha túl alacsony a [puffer], akkor a fehérje is részt vesz az áramvezetésben, ez elkenődött sávokat eredményez. Ha magas a [puffer], akkor viszont kicsi a fehérje mobilitása

23 Poliakrilamid-Gélelektroforézis Pufferrendszerek  Folytonos (diszkontinuus)  Ugyanaz a puffer a gélben és a tankban  Egyszerű, de rossz a felbontása  Diszkontinuus  2 gél  Szeparáló  Koncentráló  Alacsony [akrilamid] miatt nem érvényesül a molekulaszűrő hatás  3 puffer – két különböző anion  A két gélben az anion egy erős sav maradéka, amelynek disszociációs foka nem függ a közeg pH-jától, azaz töltése széles pH tartományban állandó  A tank pufferben az anion egy gyenge sav savmaradéke, glicinát anion Pufferrendszer hatása  Tankban a pH 8,3, a koncentráló (felső) gélben pH 6,5-6,8  A koncentráló gélben a glicin ikerionos állapotban van, lecsökken a töltéssel rendelkező molekulák száma, megnöveli az elektromos ellenállást – állandó az áramerősség, megnő a térerő (Ohm-törvény)  Fehérjék vándorlása emiatt felgyorsul, amíg eléri a kloridionokban gazdag frontot, itt összetorlódnak a fehérjék  A szeparáló (alsó) gélben a pH 8,8-9,0  a glicin töltése negítív, így megszűnik a koncentráló hatás, tehát a fehérjék fajlagos töltésük szerint vándorolnak, illetve érvényesül a gél molekulaszűrő hatása

24 Gélelektroforézis – Felhasználási területek Natív-PAGE: Natív fehérjék elválasztása  A közeg natív, tehát megmaradhat pl. az enzimaktivitás a natív szerkezet  A gél pH-jánál alacsonyabb pI értékű fehérjék vizsgálhatóak: puffer megválasztásának fontossága!  A mozgékonyság itt önmagában nem ad információt a méretről illetve a töltésmennyiségről SDS-PAGE: Denatruált fehérjék elválasztása molekulatömeg szerint  SDS: Nátrium-dodecil-szulfát – anionos detergens és fehérjedenaturáló szer Izoelektromos fókuszálás: Fehérjék elválasztása izoelektromos pont szerint  Minden fehérje addig vándorol, míg a környezet pH-ja meg nem egyezik a pI értékével  pH gradienst tartalmazó gél 2D-PAGE: Izoelektromos fókuszálás + SDS-PAGE Agaróz gélelektroforézis: nagyobb nukleinsavak méret szerinti elválasztása  A poliakrilamid gél pórusmérete kicsi, emiatt agaróz gélt használnak  Festék: etídium-bromid, SyberGreen

25 SDS-Poliakrilamid-Gélelektroforézis SDS-PAGE: Denatruált fehérjék elválasztása molekulatömeg szerint SDS: Nátrium-dodecil-szulfát anionos detergens és fehérjedenaturáló szer Forralás hatására köt a fehérjéhez egyenes arányban az aminosavtagszámmal Marker: Fehérjelétra Brómfenolkék (3',3",5',5" tetrabromophenolsulfonphthalein) Coomassie Brilliant Blue (C 45 H 44 N 3 NaO 7 S 2)

26 A célfehérje izolálása Durva frakcionálás Differenciál centrifugálás: Szedimentációs koefficiens Kisózás-Besózás (ammónium-szulfát) Dialízis Frakcionálás szerves oldószerrel Szekeltív denaturáció Célfehérje tisztítása két lépésben: 1.Sejt többi fehérjéjétől való elkülönítés 2.Mérésre alkalmas minta előállítása

27 Tisztítási lehetőségek: Biológus kromatográfia Ioncsere Töltéssel rendelkező molekulák egyik leghatékonyabb elválasztási technikája Oldhatatlan hordozó (mátrix) felszínéhez kovelensen töltött csoportok vannak kötve A mátrix Hidrofób: szubsztituált polisztirol, vízlágyításra jó, a fehérjéket többnyire kicsapja Hidrofil: cellulóz, dextrán (Sephadex), szintetikus polimer (monoBead, TSK) Töltött csoportok: Ha pozitív töltésű, akkor negatívat köt: Anioncsere – Q, DEAE, QAE Ha negatív töltésű, akkor pozitívat köt: Kationcsere – CM, SP, S Gélszűrés Töltet um átmérőjű porózus, hidrofil gélszemcsékből áll Két folyadéktér alakul ki Gélszemcséken kívüli szabadon mozgó (gyors) Gélszemcséken belüli korlátozottan mozgó (lassú) A molekulák mozgása attól függ, hogy képes e bejutni diffúzóval a gélszemcse belsejébe Reverz fázisú kromatográfia (RPC), Hidrofób kölcsönhatás kromatográfia (HIC) Hidrofil gélek felszínénz kovalensen kötött alkil szubsztituensek RPC: C4-C18 szubsztituenssel, szubsztitúció foka magas HIC: C2-C8 szubsztituens, szubsztitúció foka alcsony

28 Tisztítási lehetőségek: Affinitás kromatográfia Affinitás: Antitest – Antigén Enzim – Szubsztrát, Szubsztrátanalóg Hormon – Receptor Glutation – GST Fém-kelát – HIS-tag IMAC = Immobilized Metal Affinity Chromatography Agaróz gyantához kapcsolva nitirtilotriecetsav képes fémionok megkötéséreA hisztidin imidazol oldallánca deprotonált állapotban képes koordinációs kötést létesíteni fémionokkal Fehérjék kötésére használt fémionok: Cu, Co, Ni Foszforilált fehérjék kötésére használt fémionok: Fe, Zn, Ga

29 Tisztítási lehetőségek: IMAC Folyamata: 1.Szobahőmérsékletűre „melegítjük” oszloptérfogatnyi dH2O-val eltávolítjuk a tárolásra használt 20% etanolt oszloptérfogatnyi pufferrel egyensúlyba hozzuk az oszloptöltetet 4.Felvisszük rá a mintánkat a mintát előzőleg fecskendőszűrővel átszűrjük, minél lassabban visszük fel a mintát, annál jobban járhatunk a kötődést illetően oszloptérfogatnyi mosó pufferrel eltávolítjuk az oszlopról a nem-specifikusan kötődő fehérjéket oszloptérfogatnyi eluáló pufferrel eltávolítjuk a célfehérjét oszloptérfogatnyi dH2O-val mossuk az oszlopot oszloptérfogatnyi 20% EtOH-val mossuk az oszlopot, majd a hűtőbe rakjuk Eluálás Lépcsős vs. Gradiens Imidazol vs. pH

30 Tisztítási lehetőségek: IMAC „Profinity IMAC resin” kémiai kompatibilitása Ajánlott, hogy a pufferben legyen 50mM NaH2PO4, és 300mM NaCl Nikkeltelenítés: EDTA Redukálószerek : b-merkaptoetanol max 30mM, DTT max 5mM, TCEP 5mM Denaturálószerek : 6M Gdn.HCl, 8M Urea, 1% SDS Pufferek – Denaturált fehérjék tisztításához Egyensúlyba hozás: 6M Gdn.HCl, 50mM NaH2PO4, 300mM NaCl, pH8 Mosó puffer: 6M Gdn.HCl, 50mM NaH2PO4, 300mM NaCl, pH6 Eluáló puffer: 6M Gdn.HCl, 50mM NaH2PO4, 300mM NaCl, Pufferek – Natív fehérjék tisztításához Egyensúlyba hozás: Natív Feltáró pH8 (50mM NaH2PO4, 300 mM NaCl, 0,2g Na-azid) Mosó puffer: pH8, 50mM NaH2PO4, 300 mM NaCl, 0,2g Na-azid, 5mM imidazol Eluálás: eluáló puffer (50mM NaH2PO4, 300 mM NaCl, 250 mM imidazol, 0,2g Na-azid

31 A TC5b esettanulmánya Az expresszálódó célfehérje: His-Ubiquitin-TC5b Tapasztalatok alapján a szolubilis fázisba kerül – natív állapotban tisztítható Első tisztítási lépés: Ni-affinitás-kromatográfia Fúziós fehérje hasítása Ubiquitin hidrolázzal Második tisztítási lépés: Ni-affinitás-kromatográfia Harmadik tisztítási lépés: HPLC

32 A TC5b esettanulmánya Transzformálás – Telep – Folyadékkultúra indítása Nagyexpresszió Sejtek feltárása SDS-PAGE: HIS-UBQ-TC5b a szolubilis fázisban Ni-affinitás kromatográfia Dialízis – imidazol eltűntetése Hidrolázos (YUH) emésztés „anti-His-tag” kromatográfia HPLC MS


Letölteni ppt "Rekombináns fehérjék előállítása bakteriális expressziós rendszerben."

Hasonló előadás


Google Hirdetések