Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Humán Genom szekvencia és variabilitás Gabor T. Marth, D.Sc. Department of Biology, Boston College Orvosi genomika kurzus – Debrecen, Hungary,

Hasonló előadás

Az előadások a következő témára: "Humán Genom szekvencia és variabilitás Gabor T. Marth, D.Sc. Department of Biology, Boston College Orvosi genomika kurzus – Debrecen, Hungary,"— Előadás másolata:

1 Humán Genom szekvencia és variabilitás Gabor T. Marth, D.Sc. Department of Biology, Boston College Orvosi genomika kurzus – Debrecen, Hungary, May 2006

2 Az előadás átteknitése 1. Genom szekvenáló stratégiák, szekvenáló informatika 2. Genom érdekességek, funkcionális és struktúrális jellegzetességek a humán genomban 3. Genom variabilitás, DNS nukleotid, struktúra és epigenetikus variációk

3 1. A humán genom szekvencia

4 A nukleáris genom (kromoszóma)

5 A genom szekvencia az eredeti templát, melyen körvonalazódtak genetikai kódunk funkcionális jellegzetességei (gének, regulátor elemek, másodlagos szerkezet, harmadlagos szerkezet, stb.)

6 Teljes genomok ~1 Mb ~100 Mb >100 Mb ~3,000 Mb

7 Főbb genom szekvenáló stratégiák Klón-alapú shotgun szekvenálás Teljes-genom shotgun szekvenálás Human Genome ProjectCelera Genomics, Inc.

8 Hierarchikus genom szekvenálás BAC könyvtár készítése klón térképezés shotgun alklón könyvtár készítése szekvenálás szekvencia rekonstrukció (szekvencia összeállítása) Lander et al. Nature 2001

9 Klón térképezés – “sequence ready” térkép

10 Hierarchikus genom szekvenálás BAC könyvtár készítése klón térképezés shotgun alklón könyvtár készítése szekvenálás szekvencia rekonstrukció (szekvencia összeállítása) Lander et al. Nature 2001

11 Shotgun alklón könyvtár készítése BAC primer klón Klónozó vektor Szekvenáló vektor Alklón inzert

12 Hierarchikus genom szekvenálás BAC könyvtár készítése klón térképezés shotgun alklón könyvtár készítése szekvenálás/read processing szekvencia rekonstrukció (szekvencia összeállítása) Lander et al. Nature 2001

13 Szekvenálás

14 Robotizált automatizálás Lander et al. Nature 2001

15 Bázis „calling” PHRED bázis = A Q = 40

16 Vektor „clipping”

17 Hierarchikus genom szekvenálás BAC könyvtár készítése klón térképezés shotgun alklón könyvtár készítése szekvenálás/read processing szekvencia rekonstrukció (szekvencia összeállítása) Lander et al. Nature 2001

18 Szekvencia összeállítása PHRAP

19 Az ismétlődő DNS szekvenciák nehezítik az összeállítást

20 Szekvenálás befejezése (finishing) CONSED, AUTOFINISH hézag kis szekvencia lefedettségű és/vagy rossz minőségű régiók

21 2. Humán genom annotáció

22 Genom annotáció – Célok Fehérje kódoló génekRNS gének ismétlődő elemek GC tartalom


24 Kódoló gének – ab initio predikciók ATGGCACCACCGATGTCTACGTGGTAGGGGACTATAAAAAAAAAAA Open Reading Frame = ORF Stop kodon Start kodon PolyA szignál

25 Ab initio predikciók Gén struktúra

26 Ab initio predikciók …AGAATAGGGCGCGTACCTTCCAACGAAGACTGGG… splice donor hely splice acceptor hely

27 Ab initio predikciók Genscan Grail Genie GeneFinder Glimmer etc… EST_genome Sim4 Spidey EXALIN

28 Homológián alapulú predikciók ATGGCACCACCGATGTCTACGTGGTAGGGGACTATAAAAAAAAAAA ACGGAAGTCT más szervezetből származó ismert kódoló szekvencia GGACTATAAA expresszált szekvencia homológia által megjósolt gének Genomescan Twinscan etc…

29 Összesítés – gén predikciós rendszer Otto Ensembl FgenesH Genscan Grail Genewise Sim4 dbEst

30 ncRNS gének Szerkezet alapján történő predikció (pl. tRNS-ek) újabb ncRNS-ek esetén csak a homológián alapuló megközelítések voltak sikeresek

31 Ismétlődő annotáció „Repeat annotation”: szekvencia hasonlóságokon alapszik, hogy felismerjük az ismétlődő elemeket az ismétlődő szekvenciák könyvtárában

32 A humán genom térképe

33 Gén annotációk – kódoló gének száma Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

34 Gén annotációk – gének mérete Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

35 Gén annotációk – gének funkció Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

36 GC tartalom és kódoló potenciál Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

37 ncRNS-ek Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

38 Szegmentális duplikációk Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

39 Ismétlődő elemek Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

40 Gének és ismétlődések

41 Fizikai vs. genetikai térkép (Mb/cM) 0.4 cM1.3 cM0.7 cM 0.4 Mb0.7 Mb0.3 Mb

42 3. Humán genom variabilitás

43 DNS szekvencia variációk a referencia humán genom szekvenciája 99.9%-ban azonos más ember szekvenciájával a szekvencia-variációk teszik egyedivé genetikai mintázatunkat SNP a leggyakoribb variációs forma a „single-nucleotide polymorphisms” (SNP) – 10 millió SNP-et ismerünk ma

44 DNS szekvencia variációk inzerció-deléció (INDEL) polimorfizmusok

45 Szerkezeti variációk Speicher & Carter, NRG 2005

46 Szerkezeti variációk Feuk et al. Nature Reviews Genetics 7, 85–97 (February 2006) | doi:10.1038/nrg1767

47 Szerkezeti variánsok azonosítása Feuk et al. Nature Reviews Genetics 7, 85–97 (February 2006) | doi:10.1038/nrg1767

48 Epigenetikus változások: kromatin struktúra Sproul, NRG 2005

49 Epigenetikus változások : DNS metiláció Laird, NRC 2003

Letölteni ppt "Humán Genom szekvencia és variabilitás Gabor T. Marth, D.Sc. Department of Biology, Boston College Orvosi genomika kurzus – Debrecen, Hungary,"

Hasonló előadás

Google Hirdetések