Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai Tanszék.

Hasonló előadás


Az előadások a következő témára: "Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai Tanszék."— Előadás másolata:

1 Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai Tanszék

2 A megfejtetlen rejtély: az élet keletkezése  Tudjuk, hogy van élet  Ha találunk egy utat, akkor sem lehetünk biztosak benne, hogy azt az utat járta be az Élet

3 Út az élethez – Az összetettség növekedése Monomer Makromolekula Funkció szerzés Protosejtté integrálás

4 Funkció szerzés AnyagcsereEnzim Indormáció hordozó templát Kódolja Replikál Monomert állít elő Membrán Monomert állít elő Kompartmentalizál

5 A monomerek és makromolekulák prebiotikus szintézise FunkcióMonomer Makromolekula katalizátor (enzim) aminosav fehérje információ hordozó nukleotid (bázis, cukor) DNS / RNS membrán zsírsavak micella, lipid vezikulum

6 Molekuláktól az első sejtig  Aminosavak – Fehérjék – Enzimek  Nukleotidok – DNS/RNS – Genetika alapjai  Lipidek – Membárnok – Felszínek  RNS Világ  Információ replikáció - Eigen Paradoxona  Az élet kódja: Transzláció A genetikai kód eredete  Az utolsó közös ős - Az első protosejt

7 Aminosavak – Fehérjék - Enzimek

8 Aminosavak

9 Prebiotikus szintézis  Kiindulási anyagok elérhetőek prebiotikus körülmények között  A szintézis útja elképzelhető prebiotikus körülmények között

10 Miller-Urey kísérlet  Metán (CH 4 )  Ammónia (NH 3 )  Hidrogén (H 2 )  Víz (H 2 O)  Elektromos kisülés Aminosavak (glicin, szarkozin, alanin)

11 Makromolekulák: Fehérjék  Prebiotikus körülmények között nem állnak össze.

12 Nukleotidok – DNS/RNS – Genetika alapjai

13 Nukleotidok  Nukleotid = nukleobázis + ribóz + foszfát  DNS/RNS alkotó elemei GMP AMP dTMPUMP CMP

14 Formóz reakció

15 Nukleobázisok CitozinUracilTiminAdeninGuanin Pirimidin bázisok Purin bázisok

16 Cianid polimerizáció

17 Genetika kémiai alapjai: Bázispárok  A C-G és a A-U(T) bázispárok hidrogéngidakkal kapcsolódnak  Minden esetben egy nagyobb térigényű bázis (G v. A) van szemben egy kisebb térigényű bázissal (C v. U/T)  DNS / RNS kettősspirál

18 Makromolekulák: Oligonukleotidok  tagú oligomerek montmorillonit agyag felszíneken előállnak  Montmorillonit vulkanikus hamuból keletkezik

19 Lipidek – Membárnok - Felszínek

20 Lipidek  Glicerin + zsírsavak + foszfátcsoport  Hidrofil fej és hidrofób farok  Telített vagy telítetlen zsírsavak  Prebiotikus körülmények között a hosszú egyenes zsírsavak keletkezése nehézkes.

21 Membrán kialakulás A micellák és membránok autokatalitikusan kialakulnak Ön-összeszerelődés (self-asembly)

22 Felületek  A felületek előnyösek termodinamikailag  Katalitikus aktivitásuk lehet  Az ásványi felszínek védhetnek az UV sugárzástól  Az ásványi felszínek elősegíthetik a homokiralitást  „Szegény ember” kompartmentalizációja

23 Kompartmentalizáció  A lipid membrán fontos, mert így elérhető, hogy a belső és a külső környezet eltérjen: –Fontos anyagok benntartása (aminosavak, ATP) –H + grádiens –pH, sókoncentráció  Transzport szükséges!

24 Az élet építőkövei A monomerek és makromolekulák prebiotikus szintézise FunkcióMonomer Makromolekula katalizátor (enzim) aminosav fehérje ? információ hordozó nukleotid (bázis, cukor) ? DNS / RNS membrán zsírsavak ? micella, lipid vezikulum

25 Az RNS Világ

26 A DNS / fehérje világ előtt… Ma élő élőlényekben  Az információDNS-ben tárolódik  Fehérjék az enzimek FehérjeDNS Kódolja Replikál Monomert állít elő

27 … egy RNS világ volt RNS enzimként is működhet és információt is tárolhat! DNS stabilabb és a fehérjék jobb enzimek RNS Replikálódik, hogy enzimet kapjunk Reakciókat katalizál, monomert állít elő

28 RNS világ bizonyítékai a mai szervezetek biokémiájában I Természetes RNS enzimek (ribozim) Mindegyik RNS hasítást katalizál –I. Csoportbeli intronok –II. Csoportbeli intronok –RNáz P –Kalapácsfej –Hajtűhurok –Hepatitis Delta Vírus –Neurospora Varkund Satelite RNA Joyce, G. (2002) Nature 418: alapján

29 RNS világ bizonyítékai a mai szervezetek biokémiájában II: Koenzimek   Koenzimek: valamilyen specifikus kémiai csoport átadásában résztvevő metabolitok (rengeteg reakcióban) – –Acetyl koenzim A (koenzim A): acetyl csoport – –NADH, FADH 2 (NAD +, FAD): hidrogén és elektron – –ATP (ADP): nagyenergiájú foszfát ATP CoA FAD NADP NAD

30 RNS világ bizonyítékai a mai szervezetek biokémiájában III  Dezoxi-ribonukleotidok ribonukleotidokból keletkeznek (de ezt valószínűleg ribozimek nem tudják katalizálni).  Riboswitches: Génreguláció vélhetően legősibb formája. Az mRNS térszerkezete határozza meg, hogy lefordítódik fehérjévé.

31 RNS világ bizonyítékai a mai szervezetek biokémiájában IV: Transzláció  mRNS  tRNS  riboszóma A DNS  fehérje „átmentet” (transzláció) RNS közvetítésével történik Riboszómában a peptidil transzfert egy ribozim végzi!

32 RNS világ lehetőségei:  RNS szintézis: Nukleotid képzés pirimidinből és aktivált ribózból; Polinukleotidok 5’ foszforilációja; 5’ foszfát aktiválása 5’,5’ pirofoszfát kötött nukleotid kapcsolással; Ligáz aktivitás;  Legjobb szintetáz kb. 200 bázis hosszú és 14 nuklotidot tud egy templát alapján hozzákapcsolni egy oligonukleotid lánchoz 97.5%-os másolási hűséggel.  Protein szintézis: Minden lépés megoldható. Aminosavak aktiválása (sokféle aminoaciláció); Peptid kötés kialakítás (peptidil transzfer)  Membrán transzfer  Redoxi reakciók (NAD függő alkohol dehidrogenáz)  Egyéb reakciók (amid kötés bontás, alkiláció, porfirin metiláció, kén alkiláció, Diels-Alder cikloaddíció, amid kötés kialakítás, hidas bifenil izomeráció)

33 Információ replikáció Eigen Paradoxona

34 Információ replikáció  A replikáció nem hibátlan (főleg nem replikáz és javító mechanizmusok nélkül)  A másolás pontossága korlátozza a fenntartható információ hosszát.  Mekkora információ (milyen hosszú RNS szál) tartható meg adott másolási pontosság mellett?

35 „Replikáció” egy példája RNA RGA RNA RNX RNA RNH DNM RNA RQA RNA RNJ RPA WORLD WORLF WORLD WORLL IDRYD WORLD KORLD WORLD WERLD WORUD WORLD WORHD WORLD WORWD WORLD WRRLD HYPOTHESIS EYPKTHYSII HYPEXHESIS HYPOTHESIS HYPETHESKS HYYOTHESIS HYPOTHESIS HYPOSHESIS HYPOTMESIS HTPOTHESIS CYPOTGESIS HYPOTHEGIA HYPOXHLSIS HYPXTHESIS HYPOTHESIS HYPUTHESIS

36 Nhossz lns a mesterkópia szelekciós fölénye q másolási pontosság Eigen Pradoxona és a hibaküszöb Nincs enzim nagy genom nélkül, és nincs nagy genom enzim nélkül Swetina és Schuster 1998 alapján

37 Szekvencia vs. Szerkezet DNS fehérje Átíródik ATCGTCTGTCGGCGAT GCATGACTCATATGC A szekvenciát kell megtartani Mutáns : rátermettség 0 GCAUGACUCAUUAUGC Structure has to be maintained Mutáns : Azonos rátermettség RNS AUCGUCUGUCGGCGAU

38 RNS szerkezet  Az enzimaktivitás a szerkezettől függ  A ribozim fenotípusa a szerkezete  Kevesebb szerkezet van, mint szekvencia  Egy kevés mutáció általában nem változtatja meg a szerkezetet  Szerkezet könnyebben fenntartható, mint a szekvencia. (fenotipikus hibaköszöb)

39 1D-2D-3D szerkezet AAACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAUAUUACCUGGUA

40 Az élet kódja: Transzláció A genetikai kód eredete

41 Transzláció eredete  Fehérjék jobb katalizátorok (4 kémiailag hasonló bázis vs. 20 kémiailag sokféle aminosav)  Mivel az RNS központi szerepet játszik a transzlációban, így valószínűleg az RNS világban „találták fel”

42 Kódtábla

43 Néhány tény a genetikai kódról  Közel univerzális  Redundáns  Miért triplet? –A triplet optimális a reverzibilis kapcsolódáshoz  Miért 20 aminosav? –Az enzim sokféleség növekszik a több aminosavval, de a mutációs robusztusság csökken.  A kód optimálizált mutációs robosztusságra

44 Az utolsó univerzális közös ős

45 Protosejt  Replikáció  Komplex anyagcsere  Membrán / Kompartmentalizáció ? evolúció

46 Az utolsó univerzális közös ős  mRNS proofreading és javítás minden élőlényben azonos. A transzláció és a transzkripció is.  DNS proofreading és javítás nem!  LUCA-nak RNS genomja volt!  Fehérjeszintézissel a minimális genomméret körülbelül bp  Egy ribo-organismus minimális genomja kb bp; génnel

47 A megfejtetlen rejtély RNS Oligo-nukleotidok ásványi felszínen nukleotidok ribozimok

48 DNS A megfejtetlen rejtély fehérje RNS Kódolja replikálja monomert állít elő Membrán monomert állít elő


Letölteni ppt "Az élet keletkezése Dr. Kun Ádám, Ph.D. tudományos főmunkatárs okleveles biológus, okleveles vegyész ELTE, Növényrendszertani és Ökológiai Tanszék."

Hasonló előadás


Google Hirdetések