Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR.

Hasonló előadás


Az előadások a következő témára: "B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR."— Előadás másolata:

1

2

3

4

5

6 B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN

7 SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR ÁTRENDEZETT H+PÓT L JELÁTVIVŐ RECEPTOR ANTIGÉN FELISMERŐ ÉS JELÁTVÍVŐ RECEPTOR

8 A differenciáció szakaszait a csontvelőben a génátrendeződés foka is jelzi B SEJT ÁLLAPOT IgH GÉN KONFIGURÁCIÓ ŐssejtKorai pro-BKésői pro-BNagy pre-B Csíravonal D H to J H V H to D H J H VHDHJHVHDHJH Az Ig L-lánc még nincs átrendezve Pre-B sejt receptor kifejeződése

9 Csontvelői sztróma sejtek Fejlődő B sejtek

10 B B Stroma sejt

11 Termelt faktorok – CITOKINEK Kolónia stimuláló faktorok Növekedési faktorok Differenciációs faktorok 2. A sztróma sejtek citokineket termelnek B A CSONTVELŐI SZTRÓMA SEJTEK TÁPLÁLJÁK/SEGÍTIK A FEJLŐDŐ B- LIMFOCITÁKAT A citokinek és a közvetlen sejt-sejt kölcsönhatások a differenciáció során változnak Sztróma sejt 1. Specifikus sejt-sejt kölcsönhatás a sztróma sejtek és a B-sejtek között Sejt-sejt kölcsönhatás

12 Korai pro-B c-Kit Receptor Tyrosine kináz Stem cell factor (SCF) Sejthez kötött növekedési faktor VLA-4 (Integrin) HSC A fejlődés egyes szakaszaiban a citokinek és sejtkölcsönhatások változnak Sztróma sejt Sejt adhéziós molekulák VCAM-1 (Ig superfamily)

13 Interleukin-7 receptor Sztróma sejt Késői pro-B Pre-B Interleukin-7 Növekedési faktor Korai pro- B VLA-4 (Integrin) VCAM-1 (Ig superfamily) A fejlődés egyes szakaszaiban a citokinek és sejtkölcsönhatások változnak

14 Development A korai limfocita alakok IL receptorokon keresztüli túlélő szignálokat igényelnek. Ez hatással van a progenitorok számára, és az antigén receptor átrendeződésre is. IL7 kell mind a T mind B progenitoroknak. Jak1, 3; Ras, MAPK, útvonalakat aktivál. IL7, yc lánca vagy JAK-3 kiütés a erősen gátolja a limfocita fejlődést. BCL-2 családot szabályoz. BCL-2 overexpresszió helyreállítja T-sejtek esetében (de nem B) az IL7 hiány okozta fejlődési hibát. BCL-2, BCLxL sem kell a fejlődéshez. MCL-1 hiánya növeli az apoptózist, megállítja a fejlődést az átrendeződés előtt, mint az IL7 hiánya. MCL-1 rövid félélet idejű antiapototikus BCL-2 család tag. Ubiquitnnel bomlik. Foszforiláción ill ubin kersztül gyorsan szabályozódhat. Proapoptotikus? Bad def nincs hatása, Bim deficiens rezisztens a növekedési faktor megvonásra. IL7 hiány tüneteit a Bim hiány csaknem teljesen helyreállítja. PUMA deficiens is hasonló hatású. Szineregiztikusak. (B- sejen a PUMának nincs hatása, csak Bim) Bax hiány részlegesen helyreállít, (de nem Bsejteken) azaz Bim aktiválja Bax-ot. Bax, Bak kettős kiütés teljesen rezisztens B és T sejteken is növekedési faktor hiányra. Nem kell tudni

15 Perifériás A B sejt fejlődés szakaszai Őssejt - HSCKorai pro-B sejtKésői pro-B sejt Kis pre-B sejtÉretlen B sejtérett B sejt Az egyes érési fázisokat sejtfelszíni markerek megjelenése (vagy eltűnése) jellemzi Csíravonal D H to J H V H to D H J H VHDHJHVHDHJH Nagy pre-B sejt Pre-receptor Y Receptor H+L

16 B sejt receptor Átmenetileg jelenik meg a membránban produktív V H D H J H C H  átrendeződés után VpreB/ 5 – pót L-lánc, a membrán kifejeződéshez szükséges Ig  & Ig  jelátvivő molekulák CH  H-lánc V H D H J H V-preB 5 A pre-B sejt receptor liganduma nem ismert? Pre-

17 1. keret leolvasása MKXLWFFLLLVAAPRWVLSQVHLQES GPGLGKPPELKTPLGDTTHTCPRCPEP KSCDTPPPCPRCPEPKSCDTPPPCPRC PEPKSCDTPPPCXXCPAPELLGGPSVFL FPPKPKDTLMISRTPEVTCVVVDVSHE DXXVQFKWYVDGVEVHNAKTKLREE QYNSTFRVVSVLTVLHQDWLNGKEYK CKVSNKALPAPIEKTISKAKGQPEEMTK NQVSLTCLVKGFYPSDIAVEWESNGQP ENNYNTTPPMLDSDGSFFLYSKLTVDK SRWQQGNIFSCSVMHEALHNRYTQK SLSLSPGK* Human IgG3 Heavy Chain nucleotide sequence ATGAAACANCTGTGGTTCTTCCTTCTCCTGGTGGCAGCT CCCAGATGGGTCCTGTCCCAGGTGCACCTGCAGGAGTC GGGCCCAGGACTGGGGAAGCCTCCAGAGCTCAAAACCC CACTTGGTGACACAACTCACACATGCCCACGGTGCCCAG AGCCCAAATCTTGTGACACACCTCCCCCGTGCCCACGGT GCCCAGAGCCCAAATCTTGTGACACACCTCCCCCATGCC CACGGTGCCCAGAGCCCAAATCTTGTGACACACCTCCCC CGTGCCCNNNGTGCCCAGCACCTGAACTCTTGGGAGGA CCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGATACCC TTATGATTTCCCGGACCCCTGAGGTCACGTGCGTGGTGG TGGACGTGAGCCACGAAGACCCNNNNGTCCAGTTCAA GTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGA CAAAGCTGCGGGAGGAGCAGTACAACAGCACGTTCCGT GTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTG AACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGC CCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAA AGGACAGCCCGAGGAGATGACCAAGAACCAAGTCAGCC TGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATCG CCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAACACCACGCCTCCCATGCTGGACTCCGACGGCTC CTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAG GTGGCAGCAGGGGAACATCTTCTCATGCTCCGTGATGC ATGAGGCTCTGCACAACCGCTACACGCAGAAGAGCCTC TCCCTGTCTCCGGGTAAATGA A nagy pre-B sejtek további éréséhez helyes keretű V H D H J H kapcsolat szükséges 2. Keret leolvasása (nincs fehérje) * 3. Keret leolvasása ETXVVLPSPGGSSQMGPVPGAPAGVG PRTGEASRAQNPTW* Large pre-B További differenciálódás Pre-B cell receptor kapcsolódik a sztróma sejthez Fejlődés megreked Fejlődés megreked

18 Proliferáció Y Éretlen B sejt L-lánc kifejeződés IgM a membránban IgM A pre-B sejt receptor stimulálása sejtosztódást vált ki Nagy pre-B azonos Sok nagy pre-B sejt azonos pre-B sejt receptorokkal Large pre-B Intracellular VDJC H chain V L -J L átrendeződés Osztódás leáll Pre-B receptor eltűnik Kis pre-B

19 A pre-B sejt receptor stimulálásának következményei 1.Biztosítja az egyedi specificitást Nagy Pre-B Sztróma sejt Ismeretlen ligand 3. Kiváltja a belépést a sejtciklusba 4. Túlélő szignál ALLÉL KIZÁRÁS 1.Gátolja a további H-lánc átrendeződést 2.Könnyű lánc átrendeződés

20 D – J rekombináció V – DJ rekombináció VDJ –  δ transzkripció  δ transzláció Pót könnyű lánc V – J rekombináció VJ –  (vagy VJ - ) transzkripció  vagy transzláció B-sejt mIgD mIgM AZ IMMUNOGLOBULIN GÉN SZEGMENSEK ÁTRENDEZŐDÉSÉNEK SORRENDJE Szecernált IgM ellenanyag

21 BBBB c-kit/CD44 RAG-1/RAG-2 Limfoid előalak  H átrendeződés Pót LL átrendeződés Szelekció klonális deléció A B-LIMFOCITÁK FEJLŐDÉSE A CSONTVELŐBEN PERIFERÁLIS NYIROKSZERVEK Sajátot felismerő B-sejtek Sejtfelszíni molekulák ellen MHC fehérjék A hemopoetikus sejtekre jellemző közös receptorok  apoptózis, klonális deléció Oldott molekulák ellen Háztartási gének anyagcsere termékek  funkcionális válaszképtelenség anergia Egyéb specificitás Korai pro-B Késői pro-B Pre-B Éretlen B

22 CSONTVELŐ Potenciális B-sejt készlet Saját struktúra Saját felismerés Klonális deléció PERIFÉRIÁS NYIROKSZERVEK Hozzáférhető B-sejt készlet

23 A GÉNÁTRENDEZŐDÉS LEHETŐSÉGEI V-D-J 1.allél V-D-J 2.allél   mRNS  Fehérje receptor Átrendeződés gátlása  V-J 1.allél  V-J 2.allél V-J 1.allél V-J 2.allél  Nem sikeres Sikeres  mRNS  fehérje Átrendeződés gátlása mRNS fehérje Átrendeződés gátlása

24

25

26 A T SEJTEK ÉRÉSE ÉS DIFFERENCIÁLÓDÁSA A TÍMUSZBAN

27

28

29

30

31 T- SEJT FEJLŐDÉS NK sejt Pro-T  -átrendezés T Pre-T  -átrendeződés Pre-T  Szelekció klonális deléció T T T Érett-T Limfoid előalak Érett-B c-kit/CD44 H átrendeződés Pót L L átrendeződés Szelekció klonális deléció B B B B  Pro-B Pre-B RAG-1/RAG-2

32 1.Az NK sejtek kialakulása – nincs TCR 2. A γδ és az αβ TCR kialakulása 3. Szelekciós folyamatok αβTCR – pozitív szelekció – negatív szelekció 4. A CD4+ és CD8+ T sejtek szétválása A TÍMUSZBAN ZAJLÓ T SEJT ÉRÉSI FOLYAMATOK Korai pre-T Pót α-lánc Lck szignál β átrendezés γδ T-sejt Nincs szelekció αβ NKT-sejt αβCD4+ αβCD8+ CD4+CD8+ IL-7 függő proliferáció Pro-T sikertelen β-lánc sikertelen α-lánc nincs pozitív szelekció negatív szelekció α átrendezés Késői pre-T CD4+CD8+ Double positive

33 1.Az elsődleges T sejt készlet zöme MHC-specifikus (V gének) 1-2% egy allotípusra 2.A T sejt készlet fókuszálása a saját MHC felismerésre) 3.A felesleges klónok eltávolítása 4.Az önveszélyes klónok eltávolítása 5.KÖZPONTI TOLERANCIA 6.A T sejt készlet fókuszálása az idegen felismerésre 7.Egyénre szabott optimalizált T sejt készlet a periférián 8.A CD4 és a CD8 részt vesz a pozitív szelekcióban αβTCR CD4+ CD8+ A T LIMFOCITÁK SZELEKCIÓJA A TÍMUSZBAN Tok alatti terület Kéreg Kéreg/velő határ IL-7 függő osztódás β+preTα CD4-CD8- DN CD4+CD8+ DP Velő TCRαβ TCR- sMHC+sP sMHC+iP iMHC+iP  szelekció – szelekció  – AICD nincs  PERIFÉRIÁS TOLERANCIA AICD – aktiváció indukált apoptózis

34 BARE LYMPHOCYTE SYNDROME (BLS) MHC-I hiányában – nincs CD8+ sejt MHC-II hiányában – nincs CD4+ sejt EGYMÁST KÖVETŐ α GÉN ÁTRENDEZŐDÉS POZITÍV SZELEKCIÓ 3 – 4 NAPIG A KETTŐS POZITÍV (DP) T SEJTEK POZITÍV SZELEKCIÓJA A CD4 ÉS CD8 EGYSZERESEN POZITÍV (SP) SEJTEK FEJLŐDÉSÉT IS KIVÁLTJA MHC-II + peptid komplexek CD4 toborzás a szinapszisba Tímusz epitél sejt CD4+CD8+ MHC-I + peptid komplexek CD8 toborzás a szinapszisba

35 POZITÍV SZELEKCIÓ Tímuszon belüli tanulási folyamat - nincs instrukció a specificitásra Kis aviditású saját MHC + saját peptid + TCR kölcsönhatás Tímusz epitél sejtek felszínén Saját peptidek összetétele, koncentrációja (idegen peptidek nincsenek jelen) Alacsony peptid dózis pozitív szelekciót eredményez – speciális ligand A DP T sejtek 80-90%-a hal meg a pozitív szelekcióban (2%/MHC) PASSZÍV SEJT HALÁL A NEGLEKCIÓ MIATT NEGATÍV SZELEKCIÓ Centrális tolerancia Nagy aviditású saját MHC + saját peptid + TCR kölcsönhatás Bármely tímuszon belüli antigén prezentáló sejt részvételével Epitél sejtek, csontvelői eredetű makrofágok és dendritikus sejtek Saját peptidek összetétele, koncentrációja Magas peptid dózis negatív szelekciót eredményez – speciális ligand Perifériás szövetek antigénjei? AKTÍV AKTIVÁCIÓ INDUKÁLTA SEJTHALÁL A saját MHC + idegen peptid felismerésére képes T-limfociták érésének előfeltétele a saját MHC + saját peptidekkel való gyenge kölcsönhatás SAJÁT MHC FELISMERÉSÉRE KÉPES DE A SAJÁTTAL SZEMBEN TOLERÁNS T-SEJT KÉSZLET KIALAKULÁSA A PERIFÉRIÁN FIZIOLÓGIÁS KÜSZÖB

36 Homozigóta szülők Heterozigóta gyerek A POZITÍV ÉS NEGATÍV SZELEKCIÓ EGYENSÚLYI SZEREPE A HOZZÁFÉRHETŐ T LIMFOCITA KÉSZLET KIALAKÍTÁSÁBAN Az MHC molekulák száma Pozitív szelekció aránya A negatív szelekció aránya nő az MHC számmal

37 Receptor editing


Letölteni ppt "B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR."

Hasonló előadás


Google Hirdetések