Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

Molnár Mária Judit A gének és betegségek kapcsolata Molnár Mária Judit.

Hasonló előadás


Az előadások a következő témára: "Molnár Mária Judit A gének és betegségek kapcsolata Molnár Mária Judit."— Előadás másolata:

1 Molnár Mária Judit A gének és betegségek kapcsolata Molnár Mária Judit

2 Klinikai Genetika – Genomikai Medicina A gének és betegségek kapcsolata Molekuláris biológiai metodikák Onkogenetika (solid tumorok, onkohaematológia) Kromoszóma rendellenességek, veleszületett rendellenességek és dysmorphiás syndromák Monogénes betegségek klinikai manifesztációja –Neurogenetikai betegségek –Belgyógyászati betegségek –Haematológiai betegségek –Cardiológiai betegségek –Szemészeti betegségek –Bőrgyógyászati betegségek Polygénes, multifaktoriális betegségek genetikája Személyre szabott orvoslás Közvetlenül a fogyasztók által rendelhető genetikai vizsgálatok A genetikai betegségek megelőzése: szűrés, genetikai tanácsadás A genetikai betegségek kezelési lehetőségei A genetikai orvoslás etikai és jogi aspektusai

3

4 1953

5 ÉvNobel-díjasokFelfedezés 1953F. Crick, J. Watson, M. WilkinsDNS molekula szerkezete 1965F.Jacob, J. Monod, A. LwoffGenetikai szabályozás 1966P. RousOnkogén vírusok 1968R. Holley, G. Khorana, M. NirebergA genetikai kód megfejtése 1975D. Baltimore, R. Dulbecco, H. TeminInterakció a tumor vírusok és a nuclearis DNS között 1978W. Arber, D. Nathans, H. SmithRestrictios endonuclease 1980B. Benacerraf, J. Dausset, G. SnellImmunológiai válaszok genetikai kontrollja 1983B. McClintockMobil gének (transposonok) 1985M. Brown, J. GoldsteinSejt receptorok familiáris hypercholesterinaemiában 1987S. TonegawaAntitestek genetikai aspektusa 1989M. Bishop, H. VarmusOnkogének tanulmányozása 1993R. Roberts, P. Sharp‘Split gének’ 1995E. Lewis, C. Nüsslein-Volhard, E. WieschausHomeostasis és egyéb fejlődéstani gének 1997S. PrusinerPrionok 1999G. BlobelFehérje transzport signaling 2000A. Carlsson, P. Greengard, E. KandelSignal transductio az idegrendszerben 2001L. Hartwell, T. Hunt, P. NurseSejtciklus regulátorok 2002S. Brenner, R. Horritz, J. Sulston Genetikai szabályozás a fejlkődésben és programozott sejtahalál (apoptosis) 2006A. Fire, C. MelloRNS interferencia

6 Mi a genomika ? DNS szintű variációk és a gén expressziós mintázatok összességének bioinformatikailag értékelt biológiai összhangzattana

7 Genom-Alapú Biológia „systems biology”= rendszer- szemléletű biológia  genomikai adatbázisok  „high-throughput” technológiák  bioinformatika NFkB

8 Humán Genom Program

9 “Welcome to the Genomic Era” Guttmacher and Collins, NEJM 2003;349:996 DNA 50 th Anniversary DNA 50 th Anniversary Human Genome Sequence Human Genome Sequence “DNA Changed the World: Now What?” NY Times, February 25, 2003

10 Három „törvény”  The amount of available DNA sequence data will double every 18 months  The number of available genomes will double every 18 months  The cost of sequence will drop by a factor of 2 every 18 months.

11 A modern biológia fejlődése populációk (Darwin) egyedek (Mendel) tervezett élőlények sejtek (szintetikus biológia) kromoszómákmodellek (rendszerbiológia) egyedi gének, fehérjék, molekulákegyszerre sok gén, molekula (molekuláris biológia)(genomika, proteomika, stb.) Pósfai György ábrája

12 A DNS-ben lévő információtömeg hatalmas 2 m DNS sejt– 5.9 fénynap (22 + 1) pár kromoszóma 3.2 milliárd nukleotid bázis ~ gén (genom 1.4%)

13 Egy gén DNS szekvenciájának megváltozása megváltoztathatja a kódolt fehérjét

14 FrequencyExampleRules for assigning allele to classClass of variation 5,692,700 (~93%) A/TSingle base substitution involving A,T,C, or G Single Nucleotide Polymorphism (SNP) 431,319 (~7%) T/-CCTA/GDesignated using the full sequence of the insertion as one allele, and either a fully defined string for the variant allele or a “-” character to specify the deleted allele. Deletion/Insertion Polymorphisms (DIPs) 2,440 (0.04%) gatagatagatagat a Alleles are designated by providing the repeat motif and the copy number for each allele. Microsatellite or short tandem repeat (STR) 1,859 (0.03%) (alu) / -Applies to insertion/deletion polymorphisms of longer sequence features, such as retroposon dimorphism for Alu or line elements. Named variant Az emberi sokféleség genetikai alapja Derived from dbSNP release 119

15 Az STR olyan mintázat, ahol 2 vagy több nt ismétlődik és az ismétlődő sequenciák közvetlenül egymás mellett vannak Hosszuk 2-50 bp és introni régióban vannak. STR polymorphismus azt jelenti, amikor a homolog STR locusok repeat száma az egyedek között különbözik. Egy adott elhelyezkedésű adott sequencia a genomben meghatározza az egyén genetikai profilját.

16 Combined DNA Index System (CODIS) DNA database funded by the FBI 1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggctg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaacgatag atagatagat agatagatag atagatagat agatagatag atagacagat 181 tgatagtttt tttttatctc actaaatagt ctatagtaaa catttaatta ccaatatttg 241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttata attcttaaga atatatattc 301 cctctgagtt tttgatacct cagattttaa

17 Transposon- jumping gene Class I – Retrotransposon 2 lépésben iródik át: 1. DNSből RNS transcriptióval, majd RNS ből DNS reverse transcriptióval. Ezt követően a DNS kópia az genomban új helyre ékelődik be. Class II - DNS transposon Itt az RNS nem iktatódik közbe, tarnsposonase katalizál. „Cut and paste”- a retrovirus ezzel a módszerrel integrálódik. A transposonok mutagének -Ha funkcionális génbe insertálódik tönkreteszi -annak a funkcióját - Ha elhagyja a gént a fennmaradó „lukat” nem tudja javitani a sejt - Alu elementek gátolják a mitosis and meiosis alatt a chromosomák párosodását így egyenőtlen crossovert eredményeznek és ez okozza leggyakrabban a chromosomák duplikációját.

18 Az Alu elemek a DNS erősen repetitiv szekvenciái CpG szigetekben gazdagak, max 300 bp hosszúak, melyek a human genom legmobilisabb elemei (transposon). Tartalmaz funkcionális RNS polymerase III promotert, intermedier nem-codoló elementeket, és RNS-szerű poly(A) farkat. A kis 7SL cytoplasmikus RNS-ből származik Az Alu inserciókat több human betegséggel és rosszindulatú daganattal is kapcsolatba hozták. Pl. ha kódoló régióba insertálódik: neurofibromatosis, haemophilia, agammaglobulinaemia, leukemia, emlőrák, ovárium tu alakulhat ki

19 Centralis dogma: egy gén, egy protein

20 A DNS-től a Proteomig Genom Mi történhetne? Transcriptom Mi történhet? Proteom Mi történik

21 Ac Ub SUMO Me MicroRNA P AAA Me A génszabályozás ma ismert epigenetikai tényezői Methylation Ubiquination Sumoylation Acetylation Phosphorylation Me Histone proteins

22 Lehetséges epigenetikus hatással rendelkező viselkedéses és társas tényezők Szülői magatartás Krónikus stressz Életmód Metiláció = gyengítés Acetiláció= erősítés

23 Mi történik a „rossz” patkányanya kölykeivel? Glukokortikoid receptor gén („fő stresszreceptor”) metilációja a stresszre adott válasz egyik központi meghatározója stresszelhetőség nő 1,2 ERα ösztrogénreceptor metilációja nőihormon receptor, mely az anyai viselkedést is meghatározza fogamzóképesség és anyai magatartás csökken IV BDNF metilációja általános regeneráló és öregedést gátló vegyület gyengébb ellenállóképesség, rosszabb hangulat, gyorsabb öregedés 1 Weaver et al (2004). Nat Neurosci 7(8): Szyf et al (2005). Front Neuroendocrinol 26(3-4): ,4 Champagne et al (2003, 2006) Physioll Behav, 79(3), 359–371. Biol Psychiat, 59(12), 1227– Roth et al (2009). Biol Psychiat, 65(9), 760–769.

24 98.7% -a az emberi genomnak nem kódol fehérjét („junk”?!?) 98%

25 A főbb genom technológiák DNS Sequencia Sequencia változások Kópiaszám változás SNP variációk Messenger RNS (gén expresszió) Micro RNS Protein-DNS kötődés (transcription factor binding) Specifikus proteinek szintje (mass. Spec) Protein conformatiós változások (mass. Spec) Protein-protein interactiok (mass. Spec/2-hybrid) Protein elhylezkedés Genetikai interakciók

26 GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció EXPRESSZIÓS MICROARRAY/CHIPNANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA FIZIKAI TECHNIKÁK FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika METODIKAI REPERTOIRE TELJES GENOM VIZSGÁLAT ADATBÁZISOK BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS NYELVÉSZET ELJÁRÁSOK

27 SNP

28 Genotyping Hybridization based methods – Eg. SNP microarrays Enzyme based methods – RFLP – PCR based methods Other postamplification methods based on the physical properties of the DNA – SSCP – DHPLC

29 Illumina SNP Tipizálás Single Nucleotide Polymorphisms 1 every ~1200 bp (~5M/person) > 6,200,000 validated SNPs Genomic DNA [ T/C ] ‘T’ Allele Primer A G ‘C’ Allele Primer 23&Me 399 USD SNP meghatározását kínálja

30 Microarray metodika Mintából RNS izolálás RNS minőség ellenőrzése Amplifikáció és jelölés Hibridizáció Scannelés Adatnormalizálás Feature Extraction Bioinformatikai kiértékelés Whole Human Genom Microarray Kit 4x44K – G4112F AGILENT Az összes (44.000) gén expressziójának kumulált ábrázolása

31 Array Comparative Genomic Hybridization (aCGH) Delivering decisions from DNA to investigate genomic imbalance at a much higher resolution than is possible by traditional metaphase cytogenetic techniques (FISH)

32 Reference sampleTest sample DNA DNA isolation DNA labelling Hybridization to microarray slides Scanning Microarray image Bioinformatical analysis Deletion Bioinformatical analysis Deletion Bioinformatical analysis Deletion

33 Sanger sequencing Chain termination method The key principle of the Sanger method was the use of dideoxynucleotide triphosphates (ddNTPs) as DNA chain terminators

34 Next Generation Sequencing High Throughput Techniques Lynx Pyrosequencing Illumina Solid Etc. Allele frequency determination in pooled samples derived from amplicon resequencing with Illumina

35 Orvosi Genomika –Milyen gének vesznek részt a kóros fenotípus kialakításában –A genom hogyan befolyásolja az egyes betegségekre való hajlamot a gyógyszer reaktivitást és mellékhatást – farmakogenomika –Hogyan befolyásolhatjuk a genom működését: génterápia –Mi a genom-környezet kölcsönhatásának szerepe a betegségek kialakulásában - epigenetika

36 Molekuláris genetikai diagnosztika Infektológiai diagnosztika (pl. HPV) Genetikai azonosítás –apaság, –igazságyügyi orvostan Genetikai diagnosztika –Somatikus átrendeződés tumorokban –Tumorokban megváltozó génexpressziók –Genetikai rizikótényezők –Farmakogenomika –Monogénes beteségek

37 “Except for being hit by a car when crossing the street, all human disease is genetic.” Reed Pyeritz, MD Newsweek, 1981

38 Monogénes vs Complex Betegségek

39 Monogénes Betegségek: Sikertörténet

40 0% 10%20%30%40%50%60%70%80%90%100 % Hyperlipidaemia Rheumatoid Arthritis Schizophrenia Huntington-kór gének környezet A genetikai faktorok milyen arányban vesznek részt a betegség kialakításában Heritabilitás

41 Online Mendelian Inheritance in Man (OMIM) A catalog of human genes and genetic disorders Genetic diseases

42 gén 1 gén 2 környezet Kevés gén a környezeti faktorokkal együtt magas rizikót okozhat gén 1 környezet gén 5 gén 4 gén 2 gén 3 Sok gén a környezeti faktorokkal együtt alacsonyabb rizikóval jár Komplex fenotípusok Mit várhatunk?

43 Complex polygénes betegségek génjeinek azonosítása nagy kihívás A gén variánsok hatása kicsi (gyenge genotypus- phenotypus asszociáció) A környezet, a diéta, az életstílus befolyásolja a betegségek génjeinek expresszióját – epigenetika A GWAS vizsgálatok leginkább a gyakori és nem a ritka variánsokat vizsgálták Nagy populációk szükségesek, ahhoz hogy a GWAS vizsgálatoknak statisztikai ereje legyen A klinikai vizsgálatokban sokszor rossz volt a vizsgálati terv, a populáció struktúrája, az etnikai összeállítása (az SNPk frequenciája az egyes etnikai csoportokban különböző) Sok kezdeti asszociáció nem reprodukálódott a későbbi vizsgálatokban  a klinikai validálás hibája

44 A genetikai rendellenességek típusai I.A nukleáris genom rendellenessége (23 pár kromoszóma, 3 milliárd bázis, ezer gén) 1.Kromoszóma-rendellenességek 2.Monogénes betegségek 3.Oligo- és poligénes betegségek 4.Epigenetikai módosulások II.Mitokondriális genom rendellenessége (17 ezer bázis, 37 gén)

45 Öröklődésmódok Mendeli öröklődés (AD, AR, XR, XD, Y) Multiplex allélek, komplex öröklődés- vércsoport Uniparentalis disomia (meiosis hiba) pl. Angelman sy. Genomialis imprinting –80 imprinted humán gén –(pl Prader Willi sy.) Mitochondrialis öröklődés

46 Epigenetika Angelman szindróma Súlyos mentális retardáció, ataxia, „vidám” megjelenés, epilepszia Prader-Willi szindróma Mentális retardáció, obesitas, hypogonadismus Genetikai ok: a 15q11-q13 deléciója Anyai kromoszóma deléció (UBE3A gén)Apai kromoszóma deléció Ubiquitin-protein ligase E3A methilációs probléma – sex specifikus imprinting.

47 Mitochondriális öröklődés A mitochondriális DNS: bázis, 37 gén: 13 protein (légzési lánc), 22 tRNS, 2 rRNS. De: a mitochondriális fehérjék száma ~1500. Döntő részüket a nukleáris genom kódolja! A petesejt – kópia mitokondriális DNS-t tartalmaz (polyplasmia).

48 mitochondrium/sejt Minden mitochondriumnak saját DNS-e van Az mtDNS kis, kerek, polyplasmikus, maternálisan öröklődik Nincs repair rendszere

49 mtDNS sequencia Mitochondrialis medicina Diagnostika mtDNS betegségek Populáció genetika Antropologiai marker

50 Az mtDNS populációgenetikai jelentősége Maternalis öröklődés, nincs recombináció mtDNS variációk = haplotypusok (a D-loop alapján 27 haplotypus) Filogeographia

51 Human mtDNS morbiditási térképe

52 Genetikai tesztek Biokémiai genetika Cytogenetika Molekuláris genetika

53 Biokémiai genetika Metabolitok: pl. hosszú szénláncú zsírsavak gázkromatográfiája Fehérje szerkezet: pl. dystrophin Western blot dystrophinopathiak esetében Enzimaktivitás: pl. foszforiláz aktivitás McArdle betegség, alpha glucosidase Pompe kór

54 Cytogenetika (kromoszóma rendellenességek detektálása) Klasszikus kromoszóma analízis: karyotipus Kromoszoma átrendeződések vizsgálata: speciális festési technikák Mikrodeléció szindróma, duplikációk detektálása: pl. FISH

55 Monogénes betegségek mutációs profiljai Átrendeződések Pontmutációk Nukleotid repeat expansiok

56 Gén átrendeződés Átrendeződések –Deléció Intragénikus (in frame, out of frame) pl. Duchenne MD, HNPP Nem egy génhez köthető (sokféle hatás) pl. FSH –Duplikáció pl. CMT1a (PMP22) Átrendeződések detektálása –Southern blot –Real Time PCR –MLPA –Quantitativ fluorescens fragment hossz elemzés

57 Deléció típusok eat the big mac – vad típus In frame deléció eat the big mac eat the mac– in frame deléció Out of frame deléció eat the big mac eah ebi gma – out of frame deléció

58 Pontmutációk – nem synonym egyes nukleotid polymorphizmusok Pontmutáció –Nonsense –Missense –Splice site mutáció Pontmutáció detektálása –PCR – RFLP, –Real-Time PCR –Szekvencia analízis

59 Nukleotid repeatek Ismétlődő szekvenciák (CAG, CGG, GAA, CTG, CCTG, ATTCT) a genomban Ismétlődő egységek: 3, 4, 5 nukleotid

60 Trinukleotid repeat betegségek I. típusII. típus Betegség Huntigton kór, SCA, FRAXA, dystrophia myotonica, Friedreich ataxia Ismétlődő egységCAGCGG, CTG, GAA Instabilitás fokaközepesen stabilnem stabil Repeat lefordítódik-e proteinre igennem Patológia speciális neuronok károsodása multiszisztémás betegségek Patomechanizmustoxikus proteinek hatása hypermetiláció, transkipciós interferencia, toxikus mRNS

61 Charting a course for genomic medicine from base pairs to bedside Green ED and Guyer MS: Nature 2011; 470, 204–213

62 A genetikai markerek szerepe a betegellátásban


Letölteni ppt "Molnár Mária Judit A gének és betegségek kapcsolata Molnár Mária Judit."

Hasonló előadás


Google Hirdetések