Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN. SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR ÁTRENDEZETT.

Hasonló előadás


Az előadások a következő témára: "B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN. SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR ÁTRENDEZETT."— Előadás másolata:

1 B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN

2 SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR ÁTRENDEZETT H+PÓT L JELÁTVIVŐ RECEPTOR ANTIGÉN FELISMERŐ ÉS JELÁTVÍVŐ RECEPTOR

3 A differenciáció szakaszait a csontvelőben a génátrendeződés foka is jelzi B SEJT ÁLLAPOT IgH GÉN KONFIGURÁCIÓ ŐssejtKorai pro-BKésői pro-BNagy pre-B Csíravonal D H to J H V H to D H J H VHDHJHVHDHJH Az Ig L-lánc még nincs átrendezve Pre-B sejt receptor kifejeződése

4 Csontvelői sztróma sejtek Fejlődő B sejtek

5 B B Stroma sejt

6 Termelt faktorok – CITOKINEK Kolónia stimuláló faktorok Növekedési faktorok Differenciációs faktorok 2. A sztróma sejtek citokineket termelnek B A CSONTVELŐI SZTRÓMA SEJTEK TÁPLÁLJÁK/SEGÍTIK A FEJLŐDŐ B- LIMFOCITÁKAT A citokinek és a közvetlen sejt-sejt kölcsönhatások a differenciáció során változnak Sztróma sejt 1. Specifikus sejt-sejt kölcsönhatás a sztróma sejtek és a B-sejtek között Sejt-sejt kölcsönhatás

7 Korai pro-B c-Kit Receptor Tyrosine kináz Stem cell factor (SCF) Sejthez kötött növekedési faktor VLA-4 (Integrin) HSC A fejlődés egyes szakaszaiban a citokinek és sejtkölcsönhatások változnak Sztróma sejt Sejt adhéziós molekulák VCAM-1 (Ig superfamily)

8 Interleukin-7 receptor Sztróma sejt Késői pro-B Pre-B Interleukin-7 Növekedési faktor Korai pro-B VLA-4 (Integrin) VCAM-1 (Ig superfamily) A fejlődés egyes szakaszaiban a citokinek és sejtkölcsönhatások változnak

9 A pre-B sejt receptor stimulálásának következményei 1.Biztosítja az egyedi specificitást Nagy Pre-B Sztróma sejt Ismeretlen ligand 2. Kiváltja a belépést a sejtciklusba ALLÉL KIZÁRÁS 1. Gátolja a további H-lánc átrendeződést 2.A keretben leolvasható átrendeződést hordozó pre-B sejtek osztódását eredményezi

10 Proliferáció Y Éretlen B sejt L-lánc kifejeződés IgM a membránban IgM A pre-B sejt receptor stimulálása sejtosztódást vált ki Large pre-B Sok nagy pre-B sejt azonos pre-B receptorokkal Large pre-B Intracellular VDJC H chain V L -J L átrendeződés Osztódás leáll Pre-B receptor eltűnik Kis pre-B

11 Translation in frame 1 MKXLWFFLLLVAAPRWVLSQV HLQESGPGLGKPPELKTPLGD TTHTCPRCPEPKSCDTPPPCP RCPEPKSCDTPPPCPRCPEPK SCDTPPPCXXCPAPELLGGPS VFLFPPKPKDTLMISRTPEVTC VVVDVSHEDXXVQFKWYVDG VEVHNAKTKLREEQYNSTFRV VSVLTVLHQDWLNGKEYKCKV SNKALPAPIEKTISKAKGQPEE MTKNQVSLTCLVKGFYPSDIAV EWESNGQPENNYNTTPPMLD SDGSFFLYSKLTVDKSRWQQG NIFSCSVMHEALHNRYTQKSLS LSPGK* Human IgG3 Heavy Chain nucleotide sequence ATGAAACANCTGTGGTTCTTCCTTCTCCTGG TGGCAGCTCCCAGATGGGTCCTGTCCCAGG TGCACCTGCAGGAGTCGGGCCCAGGACTGG GGAAGCCTCCAGAGCTCAAAACCCCACTTGG TGACACAACTCACACATGCCCACGGTGCCCA GAGCCCAAATCTTGTGACACACCTCCCCCGT GCCCACGGTGCCCAGAGCCCAAATCTTGTG ACACACCTCCCCCATGCCCACGGTGCCCAG AGCCCAAATCTTGTGACACACCTCCCCCGTG CCCNNNGTGCCCAGCACCTGAACTCTTGGG AGGACCGTCAGTCTTCCTCTTCCCCCCAAAA CCCAAGGATACCCTTATGATTTCCCGGACCC CTGAGGTCACGTGCGTGGTGGTGGACGTGA GCCACGAAGACCCNNNNGTCCAGTTCAAGT GGTACGTGGACGGCGTGGAGGTGCATAATG CCAAGACAAAGCTGCGGGAGGAGCAGTACA ACAGCACGTTCCGTGTGGTCAGCGTCCTCAC CGTCCTGCACCAGGACTGGCTGAACGGCAA GGAGTACAAGTGCAAGGTCTCCAACAAAGCC CTCCCAGCCCCCATCGAGAAAACCATCTCCA AAGCCAAAGGACAGCCCGAGGAGATGACCA AGAACCAAGTCAGCCTGACCTGCCTGGTCAA AGGCTTCTACCCCAGCGACATCGCCGTGGA GTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAACACCACGCCTCCCATGCTGGACTCC GACGGCTCCTTCTTCCTCTACAGCAAGCTCA CCGTGGACAAGAGCAGGTGGCAGCAGGGGA ACATCTTCTCATGCTCCGTGATGCATGAGGC TCTGCACAACCGCTACACGCAGAAGAGCCTC TCCCTGTCTCCGGGTAAATGA A nagy pre-B sejtek további éréséhez helyes keretű V H D H J H kapcsolat szükséges Translation in frame 2 (no protein) * Translation in frame 3 ETXVVLPSPGGSSQMGPVPGA PAGVGPRTGEASRAQNPTW* Large pre-B További differenciálódás Pre-B cell receptor kapcsolódik a sztróma sejthez Fejlődés megreked Fejlődés megreked

12 B sejt receptor Átmenetileg jelenik meg a membránban produktív V H D H J H C H  átrendeződés után VpreB/ 5 – pót L-lánc, a membrán kifejeződéshez szükséges Ig  & Ig  jelátvivő molekulák CH  H-lánc V H D H J H V-preB 5 A pre-B sejt receptor liganduma nem ismert Pre-

13 Perifériás A B sejt fejlődés szakaszai Őssejt - HSCKorai pro-B sejtKésői pro-B sejt Kis pre-B sejtÉretlen B sejtérett B sejt Az egyes érési fázisokat sejtfelszíni markerek megjelenése (vagy eltűnése) jellemzi Csíravonal D H to J H V H to D H J H VHDHJHVHDHJH Nagy pre-B sejt Pre-receptor Y Receptor H+L

14 D – J rekombináció V – DJ rekombináció VDJ –  δ transzkripció  δ transzláció Pót könnyű lánc V – J rekombináció VJ –  (vagy VJ - ) transzkripció  vagy transzláció B-sejt mIgD mIgM AZ IMMUNOGLOBULIN GÉN SZEGMENSEK ÁTRENDEZŐDÉSÉNEK SORRENDJE

15 BBBB c-kit/CD44 RAG-1/RAG-2 Limfoid előalak  H átrendeződés Pót LL átrendeződés Szelekció klonális deléció A B-LIMFOCITÁK FEJLŐDÉSE A CSONTVELŐBEN PERIFERÁLIS NYIROKSZERVEK Sajátot felismerő B-sejtek Sejtfelszíni molekulák ellen MHC fehérjék A hemopoetikus sejtekre jellemző közös receptorok  apoptózis, klonális deléció Oldott molekulák ellen Háztartási gének anyagcsere termékek  funkcionális válaszképtelenség anergia Egyéb specificitás Korai pro-B Késői pro-B Pre-B Éretlen B

16 CSONTVELŐ Potenciális B-sejt készlet Saját struktúra Saját felismerés Klonális deléció PERIFÉRIÁS NYIROKSZERVEK Hozzáférhető B-sejt készlet

17 A GÉNÁTRENDEZŐDÉS LEHETŐSÉGEI V-D-J 1.allél V-D-J 2.allél   mRNS  Fehérje receptor Átrendeződés gátlása  V-J 1.allél  V-J 2.allél V-J 1.allél V-J 2.allél  Nem sikeres Sikeres  mRNS  fehérje Átrendeződés gátlása mRNS fehérje Átrendeződés gátlása

18 A sikeres génátrendeződés esélyei a B sejt differenciáció során Korai Pro BKésői Pro B Pre B V H -DJ H egyik kromoszóma V H -DJ H másik kromoszóma NO YES NO B  az egyik kromoszómán  a másik kromoszómán az egyik kromoszómán a másik kromoszómán NO YES NO YES Éretlen B Y IgM  B Y IgM B D H -J H egyik kromoszóma D H -J H másik kromoszóma YES NO Intracelluláris H-lánc Pót L-lánc

19 AZ IMMUNOGLOBULINOK SZINTÉZISE ER Golgi mRNA Riboszóma Leader szekvencia Membrán Ig Szecernált Ig A H és L láncok külön riboszómákon szintetizálódnak CHAPERONOK

20 A szomatikus génátrendeződés az egyedi B-sejtekre jellemző variábilis doméneket hoz létre a VJ (L-lánc) és a VDJ (H-lánc) génszegmensek véletlenszerű rekombinációjával A B-sejtek az allél kizárás eredményeként elkötelezetté válnak egy adott variábilis szekvenciával rendelkező H-lánc és L-lánc szintézisére és ezáltal egy adott antigén felismerésére Az éretlen B-limfociták egyidejűleg IgM és IgD típusú sejtfelszíni immunoglobulint is kifejezhetnek, de a variábilis dománek szerkezete nem változik AZ ANTIGÉN JELENLÉTÉTŐL FÜGGETLEN FOLYAMATOK A B-SEJT ÉRÉS SORÁN A CSONTVELŐBEN MENNEK VÉGBE A B-SEJT ANTIGÉN FELISMERŐ RECEPTOR ÉS AZ ELLENANYAGOK SOKFÉLESÉGÉT MEGHATÁROZÓ GENETIKAI MECHANIZMUSOK

21 C1C1 C2C2C3C3C4C4 C1C1C2C2 C3C3 pA1 V D J C1C1 C2C2C3C3C4C4 C1C1C2C2 C3C3 V D J AAA A hasított RNS a pA2 helyen adenilálódik V D J CC IgM mRNA A hasított RNS a pA1 helyen adenilálódik AAA V D J CC IgD mRNA C1C1C3C3CC CC V D J C1C1 C2C2C3C3C4C4 C1C1C2C2 C3C3 DNA pA1 pA2 V D J A két poly-adenilációs hely (pA1 és pA2) alternatív használata és az mRNS hasítása révén egymással párhuzamosan kétféle mRNA képződik Az éretlen B-limfociták egyidejűleg IgM és IgD típusú sejtfelszíni immunoglobulint is kifejeznek


Letölteni ppt "B SEJT DIFFERENCIÁCIÓ A CSONTVELŐBEN. SZABÁLYOZOTT B-SEJT DIFFERENCIÁCIÓ a a Pre-B sejt Pro-B sejt Éretlen-B sejt NINCS ANTIGÉN FELISMERŐ RECEPTOR ÁTRENDEZETT."

Hasonló előadás


Google Hirdetések