Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

A rendőrség keresi a tettest A rendőrség keresi azt a személyt, aki hétfőn reggel betört az Intézetbe és dulakodás közben több késszúrással megölt egy.

Hasonló előadás


Az előadások a következő témára: "A rendőrség keresi a tettest A rendőrség keresi azt a személyt, aki hétfőn reggel betört az Intézetbe és dulakodás közben több késszúrással megölt egy."— Előadás másolata:

1

2 A rendőrség keresi a tettest A rendőrség keresi azt a személyt, aki hétfőn reggel betört az Intézetbe és dulakodás közben több késszúrással megölt egy orvostanhallgatót. Szúrásnyomok láthatóak a hát, a nyak és a has területén. A gyilkos eszköz nem került elő. A gyanúsítottról fényképet rögzített a biztonsági kamera: a kb. 25 éves feltehetőleg férfi cm magas, szürke farmert, sötét kapucnis pulóvert és maszkot viselt „Az ilyen kegyetlen gyilkosoknak nem kegyelmeznék” – mondta a biztonsági őr, aki kora reggel rátalált a vérbefagyott áldozat testére. Az eset, ami azután történt, hogy 1 héttel korábban egy diáklányt erőszakoltak meg, majd megöltek és testét az út mellé dobták, igen felkavarta a város lakóinak kedélyeit. A sorozatgyilkost 3 gyanúsított közül keresi a rendőrség. A feladatod, hogy megállapítsd melyik gyanúsítottnak a DNS mintája található a legutóbbi gyilkosság helyszínén! A feladat: Az ügy: Police released surveillance image of the suspect. Police released surveillance image of the suspect.

3 „az emberek hazudnak, de a bizonyítékok nem” Bizonyítékok típusai: -indirekt (pl. fotó) -direkt (pl. haj) -„hideg nyom” (textil) -„forró nyom” (DNS)

4 A gyakorlat: 0. mintagyűjtés a helyszínen 1.DNS extrakció 2.DNS amplifikáció (PCR) 3.DNS festés és elválasztás (gélelektroforézis) 4.Minták összevetése

5 1. feladat: DNS preparálás lymphocytákból minta: vérfoltos textil darab egy vérfoltot steril ollóval elfelezni, csipesszel Eppendorf-csőbe tenni pipettázz 1000 ul steril vizet a mintához vortex pár perc inkubálás szobahőn vortex centrifugálás 1500 rpm-el, 2 perc ig 950 ul leszív, eldob a textilmintához 150 ul 1% Chelex oldat + 50 ul ProtK pipettázása 5 percig inkubálni kézmelegben: 37 C o vortex 65 C o 2 perc, ProtK inaktiválás jégen tárolni

6 SZERVES SZŰRŐPAPÍR CHELEX lyukasztás Mosás extrakciós pufferben PCR Reagensek SDS, DTT, EDTA proteinase K INKUBÁLÁS (56 o C) Phenol, chloroform, isoamyl alcohol Vér beszárítása a speciális szűrőpapíron vér VORTEX DNS cc mérés nélkül PCR végrehajtása víz INKUBÁLÁS 1% Chelex INKUBÁLÁS(65 o C) INKUBÁLÁS (37 o C) DNS cc. mérés PCR végrehajtása CENTRIFUGÁLÁS Centrifugálás Felülúszó ELTÁVOLÍTÁSA Vizes fázis új csőbe DNS KONCENTRÁLÁS (ethanol precipitation) TE puffer Felülúszó ELTÁVOLÍTÁSA vér DNS cc. mérés PCR végrehajtása Figure 3.1, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press DNS-extrakciós protokollok

7 2. PCR 5 ul DNS mintához PCR komponensek: 31,5 ul víz 5 ul puffer mix (dNTP-t tartalmaz) 2,5 ul primer F 2,5 ul primer R 2,5 ul MgCl 2 utoljára: 1 ul ultra Fast DNS Polimeráz enzim (jégen tárolva).

8 PCR Program: CSI C o 2 min C o 10 sec C o 15 sec C o 20 sec 30x: ciklus 2-4 ismétlése 1 min 72 C o 4 C o (összesen kb. 30 min)

9 3. Gélelektroforézis adj 5 ul PCR mintát az előre elkészített 5 ul kék mintafelvívő pufferhoz. Vidd fel a mintát (10 ul) Indítsd el 30 min, 100V

10 Mire jó a PCR a gyakorlatban? ASA Allélspecifikus Amplifikáció Gyors: Egy reakcióban kivitelezhető PCR alapú módszer SNP-ek kimutatására alkalmas Egyszerre több (multiplex) reakció is végezhető párhuzamosan Specifikus: igen/nem válasz

11 (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT 1. FELADAT A felső szekvencia vad típusú (+), az alsó mutáns (-). Keressük meg a mutációt! Milyen típusú mutáció?

12 (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT A felső szekvencia vad típusú, az alsó mutáns. Keressük meg a mutációt! Milyen típusú mutáció? pontmutáció, aminósavcserét eredményez, ”misszensz”

13 (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT A felső szekvencia vad típusú, az alsó mutáns. Keressük meg a mutációt! Milyen típusú mutáció? pontmutáció, aminósavcserét eredményez, ”misszensz” Milyen módszert ismer a pontmutációk/SNP-k kimutatására?

14 (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT A felső szekvencia vad típusú, az alsó mutáns. Keressük meg a mutációt! Milyen típusú mutáció? pontmutáció, aminósavcserét eredményez, ”misszensz” Milyen módszert ismer a pontmutációk/SNP-k kimutatására? AS-PCR (allélspecifikus)

15 (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT A felső szekvencia vad típusú, az alsó mutáns. Keressük meg a mutációt! Milyen típusú mutáció? pontmutáció, aminósavcserét eredményez, ”misszensz” Milyen módszert ismer a pontmutációk/SNP-k kimutatására? AS-PCR (allélspecifikus) Tervezzen primereket a két allél allélspecifikus amplifikációjához!

16 (+) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT GAT CGC GGT AGG GAA GAT TGA 5’ PRIMEREK ELHELYEZKEDÉSE

17 (+) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT GAT CGC GGT AGG GAA GAT TGA 5’ 5’ ATG CCG GGA TCG GTT CTT AAT 3’ 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA3’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ PRIMEREK SZEKVENCIÁJA 5’ AGT TAG AAG GGA TGG CGC TAG 3’

18 (+) 5’ ATG CCG GGA TCG GTT CTT AAT CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA CTA GCG CCA TCC CTT CTA ACT 3 ’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT GAT CGC GGT AGG GAA GAT TGA 5’ 5’ ATG CCG GGA TCG GTT CTT AAT 3’ 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA3’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ PCR TERMÉKEK 5’ AGT TAG AAG GGA TGG CGC TAG 3’

19 PCR TERMÉKEK GÉLELEKTROFORÉZISE +/+ -/- +/ -

20 TT CTCT CC CTCT CTCT TT (A) (TTTTT)–(TTTTT)-primer2(chromosome 6)-ddC/ddT (TTTTT)–primer1(chromosome 20)-ddT/ddT (TTTTT)–(TTTTT)–(TTTTT)-primer3(chromosome 14)-ddC/ddT (TTTTT)–(TTTTT)–(TTTTT)–(TTTTT)-primer4(chromosome 1)-ddC/ddC (B) Sample 1 Sample 2 Figure 8.2, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press PCR termékek kapilláris elektroforézise: A primerek és így a termékek mérete a poli-T farok miatt különböző:

21 Példa: Multiplex PCR segítségével amplifikáljuk fel a 3 lókusz egy-egy allélját Locus A Locus C Locus B (B) A PCR termékeket méret alapján különítjük el kapilláris gélelektroforézissel: (A peakek jelentik a termékeket) AC B smalllarge Modified Figure 4.3 J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press Locus A Locus C (t) (RFU) RFU: relative fluorescence unit t: time 50 bp70 bp 10min15 min Deletion of Locus B Melyik termék hol fog futni?

22 PCR termék méret (bp) Figure A7.1, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press Állapítsa meg a helyszíni epitél és sperma frakció STR vizsgálata után, hogy lehetett-e a gyanúsított kapcsolatban az áldozattal?

23 egy tömegkatasztrófa áldozatának DNS-profilja: DNS-profil közvetlen bizonyítékról (pl. fogkefe): D5S818D13S317 D7S820 D16S539 CSF1PO Penta D (A)Direkt bizonyító eljárás: egy ismerten az áldozathoz tartozó tárgyon található DNS mintával hasonlítják össze az áldozatból nyert STR profilt:

24 (B) Indirekt bizonyító eljárás: Rokonvizsgálattal jósolja meg, mi lehet az apa/áldozat lehetséges STR mintázata ? fiú feleség áldozat D5S818D13S317D7S820 D16S539CSF1POPenta D 10,109,109,138,98,1411,13 fiú Feleség 10,128,108,98,12 11,13 10,109,1211,139,911,1412,13 ?,109,??,13 9,? ?,14 11,? or ?,13 apa Jósolt genotípus Aktuális genotípus Figure 24.1, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press

25 AZ FBI ÁLTAL IS HASZNÁLT EGYIK VNTR LOKUSZ (FGA) VIZSGÁLATA AZ 5 GYANÚSÍTOTT KÖZÖTT. AZ ISMÉTLŐDŐ EGYSÉG HOSSZA 4 bp, SZEKVENCIÁJA: TTTC. AZ ISMÉTLŐDÉSEK SZÁMA 5-250, TEHÁT bp HOSSZÚSÁGÚ TERMÉKEKET VÁRUNK (természetesen a két primer hosszát is beleszámítva). A PCR primereket az ismétlődések két oldalán levő (konszenzus) szekvenciákra terveztük: P1: gctagtaacggcattaccag P2: catcgcataagaatttcacg Feladat: VNTR- ANALÍZIS

26 FUTTASSA MEG GÉLEN AZ ELŐZŐ CSOPORT REAKCIÓIT, ÉS ÁLLAPÍTSA MEG, HOGY HÁNY ISMÉTLŐDÉST TARTALMAZNAK AZ AMPLIFIKÁLT ALLÉLOK! GYAKORLATI FELADAT-VNTR ANALÍZIS két primerhosszat (40bp) levonva osszuk el a DNS fragmentumhossz at 4-el, így megkapjuk az ismétlődések számát ismétlődések (tandem repeat)száma:

27 Megoldás: D1 = a pár saját lánya D2 = anya gyereke, Magyarázza el az apasági per VNTR eredényét! Melyik utód (D=lány, S=fiú) milyen rokonságban állhat a szülőkkel? Megoldás: S1 = a pár saját, biológiai fia S2 = adoptált gyerek D1:D2: S1:S2:

28 2. FELADAT VNTREllaLindaBálintKolosDonátAladárÁlmos A7 & 82 & 73 & 72 & 72 & 83 & 73 & 2 B4 & 56 & C11 & 8 11 & 99 & 1013 & 8109 & 129 & 13 D 7 & & 7 7 & 921 & 715 & 821 & 15 E10 & 612 & 66 & 912 & 917 & 10 6 & 1217 & 12 Ella keresi fel az Ön rendelőjét, lányával Lindával. Ella elmondja, hogy Linda apja az Öröm együttes valamelyik tagja. Ön az együttes tagjaitól száramazó DNS-minták alapján elvégzi a VNTR analízist. Nos, ki Linda apja? Miért? Miért különleges a B mikroszatellit?

29 2. FELADAT VNTREllaLindaBálintKolosDonátAladárÁlmos A7 & 82 & 73 & 72 & 72 & 83 & 73 & 2 B4 & 56 & C11 & 811 & 99 & 1013 & 8109 & 129 & 13 D7 & 1921 & 7 7 & 921 & 715 & 821 & 15 E10 & 612 & 66 & 912 & 917 & 106 & 1217 & 12 Ella keresi fel ön rendelőjét, lányával, Lindával. Ella elmondja, hogy Linda apja az Öröm együttes valamelyik tagja. Ön az együttes tagjaitól száramazó DNS minták alapján elvégzi a VNTR analízist. Nos, ki Linda apja? Miért? ÁLMOS Miért különleges a B mikroszatellit? X KROMOSZÓMÁHOZ KÖTÖTT

30 SNP

31 Az ASA eredménye alapján határozza meg, hogy milyen szemszínű és hajszínű lehetett a tettes! SNP Kék/zöldBarna Szőke/vör ös Barna Herc2 Rs GG/CC AA/TTGG/CCAA/TT Oca2 rs AA/TTGG/CCAA/TTGG/CC Tyr Rs AA/TTGG/CCAA/TTGG/CC IRF4 rs TT/AACC/GGTT/AACC/GG SLC24A5 rrs GG/CCCC/GGGG/CCCC/GG ExoC2 rs AA/TTCC/GGAA/TTCC/GG SZEM HAJ Gén/SNP The HIrisPlex system for simultaneous prediction of hair and eye colour from DNA Forensic Science International: Genetics Volume 7, Issue 1, January 2013, Pages 98–115 IrisPlex: A Sensitive DNA Tool for Accurate Prediction of Blue and Brown Eye Colour in the Absence of Ancestry Information Journal: A gyanúsított mintájának ASA eredménye: Rs (Herc2): AA Rs (Oca2): GG Rs (Tyr): GG Rs (IRF4): CT Rrs (SCL24A5): CC Rs (ExoC2): AC

32 áldozat gyanúsítottak marker Referencia Gél Hasonlítsa össze az amplifikált mintákat a referencia képpel! Határozza meg az ismétlődések száma alapján a gyanúsítottak közül a tettest! Ki a lehetséges tettes? 1 2 3

33 áldozat gyanúsított Marker Referencia Gél 100


Letölteni ppt "A rendőrség keresi a tettest A rendőrség keresi azt a személyt, aki hétfőn reggel betört az Intézetbe és dulakodás közben több késszúrással megölt egy."

Hasonló előadás


Google Hirdetések