Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

BIOINFORMATIKA INFORMATIKABIOINFORMATIKABIOLÓGIA “A valaha élt kutatók 99%-a kortársunk” Az adatokra is igaz  információs forradalom.

Hasonló előadás


Az előadások a következő témára: "BIOINFORMATIKA INFORMATIKABIOINFORMATIKABIOLÓGIA “A valaha élt kutatók 99%-a kortársunk” Az adatokra is igaz  információs forradalom."— Előadás másolata:

1 BIOINFORMATIKA INFORMATIKABIOINFORMATIKABIOLÓGIA “A valaha élt kutatók 99%-a kortársunk” Az adatokra is igaz  információs forradalom

2 INFORMATIKA - információk megfejtése  új információk produkálása - adatok feldolgozása, csoportosítása, megjelenítése - adatok harmonizálása Adatbevitel, adatrendezés  adatbankok Adatbankok: - adatok gyors cseréje - interaktív kapcsolat az adatbankok és a kutatók között Adatfeldolgozás, adatmegjelenítés, kiértékelés  újabb információk  újabb adatbankok automatizálás, speciális szoftverek speciális szaktudás

3 Pre-bioinformatika, az informácó hordozó megfejtése 1866 Mendel: borsó keresztezési kísérlek öröklődés egységekben 1869 Miescher: lazac sperma DNS tisztítás DNS az örökítő anyag 1903 WS Sutton az öröklődési mintázat a kromoszóma sajátságaihoz kapcsolt az osztódás során citokémia: a kromoszóma DNS-ből és fehérjéből épül fel

4 Pre-bioinformatika, az informácó hordozó megfejtése virulens baktérium nem-virulens baktérium hőkezelt baktérium nem-virulens baktérium + hőkezelt baktérium egér meghal egér túlél virulens baktérium F. Griffith Streptococcus pneumoniae  transzformálási elv Avery 1944 a transzformáló anyag DNS proteáz RNáz DNáz nincs hatás inaktivált proteáz szennyeződés?

5 DNS fehérje burok fág DNS bakteriofág fág DNS fehérje burok új fágok képződnek baktérium lizál a fágok kiszabadulnak T2 fág Hershey és Chase 1952 fágok a baktériumhoz tapadva turmixolás fehérje burok leválik 70% 32 P 20% 35 S 35 S jelölt 32 Pjelölt DNS-ben nincs S, fehérjében nincs P

6 humán sejt E. coli baktérium DNS tisztítás gyenge savas kezelés foszfodiészter kötés hidrolízis kromatográfia és a nukleotidok kvantitálása Bázis arány A:T1.00 G:C1.00 Bázis arány A:T1.09 G:C0,99 Chargaff E. nukleotid arányok Út a kettős hélixhez, Crick és Watson Biofizikai adatok, víztartalom Pauling triple hélix Röntgen diffrakciós adatok Rosalind Franklin és Maurice Wilkins fehérje alfa hélix már ismert

7 A DNS kettős hélix

8 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció DNS Gén transzkripció, RNS szerkesztés RNS degradáció fehérje transzláció, poszttranszlációs módosítás metabolomika

9 9 A BIOLÓGIAI INFORMÁCIÓ HORDOZÓ MEGFEJTÉSE GENOMIKA A teljes genetikai állomány szekvenciájának meghatározása, A szekvenciákon elhelyezkedő funkcionális régiók számítógépes jóslása: annotálás

10 10 Funkcionális genomika RNS szinten TRANSZKIPTOMIKA

11 Egy DNS chip kísérlet folyamatábrája

12 12 A chipek kiértékelése, eredménye

13 13 Funkcionális genomika fehérje szinten PROTEOMIKA

14 Proteomika EgyTipikus protokol Minta elő Izoelektromos fókuszálás SDS PAGE Láthatóvá tétel Kép analízis Protein pötty kivágás tömegspektrometria Protein azonosítás

15 15

16 16 Proteomika: az elválasztástól az azonosításig

17 SpeciesSize of genome (Mb)Approximate number of genesReferences Eukaryotes Arabidopsis thaliana (plant) AGI (2000) Caenorhabditis elegans (nematode worm) CESC (1998) Drosophila melanogaster (fruit fly) Adams et al. (2000) Homo sapiens (human) IHGSC (2001); Venter et al. (2001) Saccharomyces cerevisiae (yeast) Goffeau et al. (1996) Bacteria Escherichia coli K Blattner et al. (1997) Mycobacterium tuberculosis H37Rv Cole et al. (1998) Mycoplasma genitalium Fraser et al. (1995) Pseudomonas aeruginosa PA Stover et al. (2000) Streptococcus pneumoniae Tettelin et al. (2001) Vibrio cholerae El Tor N Heidelberg et al. (2000) Yersinia pestis CO Parkhill et al. (2001) Archaea Archaeoglobus fulgidus Klenk et al. (1997) Methanococcus jannaschii Bult et al. (1996) Eukarióta Bacteria Archaeacteria

18 18 A BIOLÓGIAI INFORMÁCIÓ HORDOZÓ MEGFEJTÉSE GENOMIKA A teljes genetikai állomány szekvenciájának meghatározása, A szekvenciákon elhelyezkedő funkcionális régiók számítógépes jóslása: annotálás

19 Az emberi genetikai állomány emberi család emberi sejt sejtmag genom mitokondriális genom 22 autoszóma 2 szex kromoszóma

20 A humán és élesztő mitokondriális genom respirációs komplex génjei riboszómális RNS gének intronok riboszómális protein gének egyéb RNS gén transfer RNS gén

21 Másik extrakromoszómális elem növényekben: kloroplaszt A rizs kloroplasztjának genomja 136 kb fotoszintézis gének riboszómális protein gének riboszómális RNS gének RNS polimeráz gén transzfer RNS gének

22 SpeciesType of organismGenome size (kb) Mitochondrial genomes Plasmodium falciparumProtozoan (malaria parasite) 6 Chlamydomonas reinhardtiiGreen alga16 Mus musculusVertebrate (mouse)16 Homo sapiensVertebrate (human)17 Metridium senileInvertebrate (sea anemone)17 Drosophila melanogasterInvertebrate (fruit fly)19 Chondrus crispusRed alga26 Aspergillus nidulansAscomycete fungus33 Reclinomonas americanaProtozoa69 Saccharomyces cerevisiaeYeast75 Suillus grisellusBasidiomycete fungus121 Brassica oleraceaFlowering plant (cabbage)160 Arabidopsis thalianaFlowering plant (vetch)367 Zea maysFlowering plant (maize)570 Cucumis meloFlowering plant (melon)2500 Chloroplast genomes Pisum sativumFlowering plant (pea)120 Marchantia polymorphaLiverwort121 Oryza sativaFlowering plant (rice)136 Nicotiana tabacumFlowering plant (tobacco)156 Chlamydomonas reinhardtiiGreen alga195

23 exon intron exon upstreamdownstream biológiai információ (kódoló régió) kezdete biológiai információ (kódoló régió) vége szabályozó elemek Eukarióta gének szerkezete altenatív splicing neurofibromatosis type I gene exons introns OGMP EVI2B EVI2A egymásba ágyazott gének

24 “Abnormális” genetikai elemek Pszeudogének keletkezése A. Processzált pszeudogén B. funkcionális gén transzkripció RNS reverz transzkripció DNS új integráció funkcionális gén pszeudogén nincs szabályozó régió funkcionális gén csonka géngénfragment a kódoló régió is sérült konvencionális pszeudogén: funkcióvesztéses mutáció

25 1 kromoszóma 2 kromoszóma interspersed repeats tandem repeated DNA Long Interspersed Nuclear Elements: LINE Short Interspersed Nuclear Elements: SINE mikroszatellitek (short tandem repeat, STR)  13 bp repeat,  150 bp hossz: pl. CACACACACACA átlagosan minden 2 kb tartalmaz miniszatellitek  25 bp repeat,  20 kbp hossz Genetikai profil analízisére alkalmasak ISMÉTLŐDŐ SZEKVENCIÁK A GENOMOKBAN

26 retrotransposon transzkripció RNS reverz transzkripció DNS új integráció retrotransposon retrotransposon kópia Retroelemek és retrotranszpozíció

27 replikatívkonzervatív DNS transpozonok eukariótákban a retrotranszpozon a jellemzőbb

28 A HUMÁN GENOM EGY SZEGMENSE

29 cirkuláris kétszálú DNS néhány fordulat kettős hélix megbomlása negatív szupertekeredett struktúra A prokarióta genom szerkezete Az E. coli nucleoidjának modell szerkezete

30 Prokarióta gének felépítése, policisztronos struktúra

31 A laterális géntranszfer szerepe különböző porkariótákban

32 Archaeák: Carl Woese: S rRNS szekvenciák  univerzális filogenetikai törzsfa Archaebaktériumok: - Eubaktérium-szerű tulajdonságok: - sejtszerveződés - sejtciklus - fő metabolikus utak - cirkuláris kromoszóma, replikáció - policisztronos operonok - Shine- Dalgarno szekvenciák (SD) - transzkripció és transzláció öszekapcsolt - génexpresszió szabályozás (regulátor fehérjék) Eukarióta-szerű tulajdonságok: transzkripció, transzláció: - promóter elemek: TATA-box (-30) - transzkripciós faktorok: TBP és TFB - RNS polimeráz sok alegységes (~12) - riboszómák:70S  16S, 23S, 5S de: eukariótákéhoz hasonló riboszómális fehérjék - transzlációs faktorok - intronok, - kis nukleoláris RNS szerű molekulák (snoRNS) - hiszton fehérjék (erősen bázikusak)  nukleoszómák (kis árok) - hősokk fehérjék (Hsp60) - citoplazmában chaperonok Evolúciós törzsfa

33 DNS MANIPULÁCIÓ számítógéppel

34 Clone Manager 6

35

36

37

38

39

40

41 DNS szekvenálás SANGER szerint +

42 KLASSZIKUS DNS SZEKVENÁLÁS PCR TERMÉKEN VAGY KLÓNOZÓ VEKTORBAN

43 Szekvenálási stratégiák Automata, Sanger-alapú piroszekvenálás Chip-alapú

44 A PCR ALAPÚ SZEKVENÁLÁS SÉMÁJA TEMPLÁT DNS PCR egy primerrel a terminálódott láncok száma a ciklus számmal növekszik a hiba nem amplifikálódik

45 AZ AUTOMATA DNS SZEKVENÁLÁS ELVE

46 AZ AUTOMATA SZEKVÁNÁLÓ A SZEKVENCIÁK MANUÁLIS ELLENŐRZÉSE

47 Genom szekvenálási stratégiák Shot gun Primer séta

48 Alternatív shot gun stratégiák térképezés: - genetikai: gének, tulajdonságok pozícionálása - fizikai: szekvenciák, gének rendeződése

49 Bakteriális shot gun könyvtár készítése

50 Preparation of shotgun library chromosomal DNA broken DNA fragments blunting the ends Preparative gel electrophoresis 2-3,5 kb fragments dephosphorylation transformationelectroporation E. coli

51 szekvenciaanalízis ellenőrzés, validáció vektor és egyéb szennyező szekvenciák eltávolítása gyenge minőségű szekvenciák eltávolítása átfedő fragmentumokból kontigok összerakása A szekvenciák feldolgozása Phrap Vector_clipping Phred SeqMan/DNASTAR STADEN programcsomag

52 Szekvenciák kontigokba rendezése, Példa

53

54

55

56

57

58

59

60

61

62

63

64

65

66

67

68 File management

69 Szekvenciák, kontiggá való összerakása I. Tévedések vígjátéka

70 összekapcsolás: kozmidkönyvtár (BAC, YAC) klónok végeinek szekvenciái két küldönböző kontigra esnek Szekvenálási lyukakNincs kapcsolat Scaffold 2 Scaffold 1 Kontig 4Kontig 5Kontig 1Kontig 2 Kontig 3 Scaffold: láncszerűen lineáris sorrendbe elhelyezett nem összeérő kontigok sora. A scaffold fogalma

71 Kontigok szuperkontigokká való összerakása

72 Összerakó algoritmusok (Assemblers) Buzgó (greedy) algoritmus Átfedési-szerkezet-konszenzus

73 De ha sikerül, és van szekvenciánk Mi van rajta,van-e gén? Honnan tudjuk, hogy Valamit találtunk, találtunk-e gént? CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGA TCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGG TCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTT CGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAG GGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGC CGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGT CCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCA TTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCG AGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC GGGAATGCTTCGTGTTGAAGTGGCCCTGGCGCGCGCGCAGGCGGCAGAGGGCCTTGTCAGTTCGGAATTGGCCGACGCGATCGAGGTTGTTGGTACTGCCGGGTTGGACCCCGAGGCGAT GGCGGCGACTACTCGCATGACAGGAGTGCCCGCAATATCGTTCGTCCGTGCGGTGCAATCGGCCCTGCCGCCCTCACTGGCGGGTGGATTTCATTTCGGCGCCACCAGTCAAGACATCGT GGATACGGCCCACGCGCTCCAGCTGGCCGAGGCACTCGATATTATAGAAGTCGATTTACACGCCACTGTCAGCGCAATGATGAATCTGGCCGCTGCTCACTGCAATACACCCTGTATCGG GCGCACGGCCTTGCAGCACGCAGCGCCAGTTACGTTCGGCTACAAGGCGTCCGGCTGGTGCGTTGCCCTGGCGGAGCATCTGGTGCAGCTTCCCGCGCTGCGAAAGCGGGTTCTGGTGGC GTCGCTAGGGGGGCCGGTTGGTACCCTTGCCGCGATGGAGGAGCGGGCCGACGCTGTACTGGAGGGTTTCGCTGCGGACCTGGGGTTGGCCATTCCCGCCCTGGCCTGGCACACGCAGCG GGCCCGGATCGTCGAGGTGGCCAGTTGGCTGGCCATATTGCTGGGAATTCTGGCAAAAATGGCCACCGATGTCGTTCACTTGTCCTCCACGGAAGTGCGCGAGCTTTCCGAACCTGTAGC GCCGGGCAGGGGGGGCTCCTCGGCGATGCCTCACAAGCGGAACCCGATTTCCTCGATTACCATCCTGTCCCAGCATGCTGCGGCAGGGGCCCAGCTCTCCATTCTCGTGAACGGCATGGC CAGTCTGCACGAACGTCCGGTGGGGGCGTGGCATTCGGAATGGTTGGCTCTGCCGACGCTGTTCGGCCTTGCCGGCGGTGCCGTGCGCGAGGGCAGGTTTCTGGCCGAGGGGCTGCTGGT CGATGCCGACCAGATGGGTCGCAATCTACAATTGACCAATGGCCTGATTTTCAGCGACGCGGTAGCCGGCCAGTTGGCAAAGCACTTGGGTCGGGCCGAGGCTTATGCCGCTGTCGAGGA TGCCGCCGCCGAGGTGTTGCGTTCAGGCGGCAGCTTTCAGGGTCAGCTGAACCAGCGCCTGCCCGATCACCGCGACGCTATCGCTATTGCTTTTGATACGACGCCGGCGATCCAGGCCGG GGCCGCCCGCTGCCGTAGTGCGCTGGATCATGTGGCTCGTATTCTTGGACCCGCCTCTACCATCGGATTTCAAGGAGGCTAATGACGTGACGACACTGTTTGAGGCGACGACCATCCCGA TTTGCGAGGGCCCGCGCGACCAGACCGCCGAGATCCTTTTCGAGATGCCGCCGGGTGCGTGGGATACCCATTTTCATGTTTTTGGCCCAGTTTCATCGTTTCCATACGCAGAACACAGGC TCTATTCCCCACCGGAGTCGCCACTTGAGGATTATCTGGTGTTGATGGAGGCTTTGGGGATCGAGCGCGGCGTTTGTGTCCATCCGAATGTTCATGGTGCCGACAATTCGGTGACGCTCG ACGCAGTTGCGCGGTCCGATGGTCGTCTGCTGGCGGTGATCAAGCCACATCACGAGATGACTTTTGTTCAGCTGCGGGACATGAAGGCGCAGGGGGTCTGCGGGGTACGTTTTGCCTTCA ATCCGCAGCATGGCTCGGGCGAGTTGGATACTCGTTTGTTCGAGCGTATGTTGGACTGGTGCCGCGACCTAGGCTGGTGCGTAAAATTGCATTTCGCGCCCGCTGCGCTGGACGGTCTGG CTGAACGTTTGGCGCGCGTCGATATTCCGATCATCATCGATCATTTCGGGCGGGTGGACACCGCGCAAGGTGTGGATCAGCCGCACTTCCTGCGTTTGCTCGATCTGGCCAAACTGGACC ATGTCTGGATCAAGCTTACGGGGGCAGATCGTATTAGCGGTTCCGGCGCGCCATATGACGATGTCGTGCCCTTCGCGCACGCTTTGGCAGATGTGGCGCCCGACCGCCTCCTCTGGGGTT CGGATTGGCCGCATTCAGGCTATTTCGATCCGAAGCACATACCCAATGACGGCGACTTGTTGAACCTTTTGGCGCGTTTTGCCCCCGATGCTGAACTGCGTCGTAAGATCCTTGTGGACA ACCCGCAGCGCCTGTTCGGGGCTGCTTGAGGAGCCGAGCCGATGCAACCTTTCGTCTACGAAACAGCCCCAGCGCGCGTCGTTTTCGGGCGCGGCACTTCGCAGAATCTGCGGCGGGAAC TTGAGGCCCTGAATTTTGGCAGGGCGCTGGTTCTTTCCACGCCCGACCAAAAAGAACAATCGCTGCGAATTGCCCAGGGCCTGGGTTCTCAGCTGGCGGGGTCGTTCCACGCCGCTGCCA TGCATACGCCTGTCGAGGTCACCTTGCAGGCGCTTGAGGTGCTGAAGGATGTGCAGGCCGATTGCATCGTGGCGATTGGCGGCGGCTCAACCATTGGGTTGGGCAAGGCACTGGCCCTGC GCACCGATCTGCCGCAGATCGTCGTCCCGACGACTTATGCCGGCTCGGAAATGACGCCGATCCTGGGAGAGACGGAAAACGGGCTGAAGACCACACAGCGTAATCCCAAAGTGCAGCCGA GGGTGGTTCTCTACGATGTGGACCTGACTGTGACGCTTCCGGTGCAGGCCTCGGTTACATCAGGCATGAATGCGATCGCCCATGCGGCCGAGGCATTATATGCGCGGGACGGCAATCCGG TGATCTCGCTGATGGCCGAAGAGGCGATCCGCGCGCTGGCCCATGCCCTGCCGCGTATCGTTGCCACTCCCGACGATATCGAAGCGCGCAGCGATGCCCTCTATGGCGCGTGGCTGTGCG GAACGTGCCTGGGTTCGGCCGGAATGGCGTTGCACCATAAGCTCTGCCACACCCTCGGCGGAAGTTTCGATTTGCCACATGCCCCGACCCACACGGTCATCCTCCCCTATGCGCTCGCCT ATAATAGTGATGCGGCCAGGCCCGCAATGGCAGCCATCGCGCGCGCGCTGGGCATGGCGGATGCAGCGATGGGCATGAGAGCGTTGTCCATGCGGTTGGGCGCCCCGACATCGCTGCGTG AGTTGGGCATGGCAGAAGCCGATCTTGACCGCGCCGCCGACCTGGCCACGCAAAATGCCTATTGGAACCCGCGACCCATCGAGCATGGGCCGATTCGTAACCTTCTGGGACGGGCCTGGG CTGGAACTCCGGTCTGAAGGACCTAGAGGACAGTCAATTCATTGATCTGAAGTCACCAACGAGGAGATATGGGATGAACGAGAACATTGCGATCCGCAAATTGGGCCGCCGACTCCGATT GGGCATTGCCGGTGGCGCGGGTCATTCGCTGATTGGTCCGGTTCACCGGGAGGCGGCTCGGCTTGACGATTTGTTCTCTCTCGATGCTGCGGTGCTGTCCAGTAACGCGGAACGCGGGGA TGCTGAGGCCGCGGCTCTCGGAATTCCGCGCTCCTATTCGTCCACCGCCGAGATGTTCGCAATGGAGAAGGCTAGGCCCGACGGTATTGAGGCCGTTGCCATAGCCACGCCGAATGACAG CCATTACCGGATTCTGTGCGAGGCGCTGGACGCCGGGTTGCATGTAATCTGCGACAAGCCTTTAACCTCCACGAAGGCCGAGGCCGACGACGTGCTGGTGCGGGCGAAGGCCGCGGGCAA GGTTGTGGTCCTGACCCACAATTATTCTGGCTACGCCATGGTACGCCAAGCCCGCGCCATGGTCGCCGCCGGTGAACTTGGGAAAATCCACCAGATTCACGGGGTCTACGCTCTGGGCCA GATGGGCCGTTTGTTCGAGGCCGACGAAGGGGGCGTGCCTCCGGGGATGCGTTGGCGGATTGATCCTGCGCGCGGTGGCGACAGTCACGCCCTGGTGGATATCGGCACCCATGTGCACCA TCTGGCTACCTTCATCACGCAGTTACAGGTCGTTGAGGTAATGGCCGATCTTGGGCCGGCGGTTCAAGGCCGCGCGGCCCATGACAGTGCCAACGTCATGTTCCGTATGGAAAACGGAGC TTTCGGATCGTTCTGGGCCACCAAGGCGGCATCGGGGGCCAGCAAGCTGGCGATCGAAGTCTACGGTGACAAGGGCGGCGTCCTGTGGGAGCAGGCCGACGCCAATAACTTGCTACATAT GCGGCAGGGCCAACCCCCAGCCCTGATTGGTCGACAAGTTGCCGGGCTGCATCCTGCGGCAATCCGCGCGATGCGGGGGCCGGGTTATCATTTCGTGGAAGGCTATCGCGAGGCCTTTGC GAATATGTACGTGGATTTCGCCGAACAGATCTTGGCCATGATGGGCAAGGGGGCCGCAGATCACCTGGCATTGGAAGCGCCGTCGGTCGTGGACGGCCTGCGCTCCATGGCGTTCATCGA AGCCTGTGTGGCGTCGTCGCAGGACCGCCAATGGCGGCAGGTGGAGCAAGTCAGTTGATCTCTCAGCGGCTTCGGCATTTTTCCCGGGCTGGCGGCTCCCCGCAGCTCCCTCCGGTGGAA AGAACGGGTAATCAAAATAATATTCTGATTTTAAAGGATGTTCCAGACAGCTGATTATTCCTGAAATTTAGGGCTCTTTCGGCTGTAGCAATTGACTAAAAGCCGAATTTAAGGGTAA TTAAACAAACGCTGTTCGTATTATTTAAACAGGTGAGTGATGGCGATATTCCTGGAAGGCTGGCCGATGGTTTCATCTGAATACCCGGCCAGAAGCGTTGAGGCGCACCCGGCCTATCTG AC GCCAGACTATGTTTTCACGCGAAAGCGTGCGCCGACTCGACCGCTGCGGTTAATTCCTCAGTCTGCGACGGAGCTGTATGGCCCGGTTTATGGACAAGAGAGCGTCCGTCCGGGGGATAA CGACCTGACCCGTCAGCACGAAGCTGAGCCGGTGGGGGAGCGGATTCTGGTGACGGGGCGCGTGACCGACGAAGACGGGCGGGGTGTCCCTAATACGCTGCTAGAGATCTGGCAGGCCAA TGCCGCCGGTCGCTATATCCACAAGCTTGACCAGCATCTTGCCCCGCTTGATCCAAATTTCTCGGGGGCAGGGCGTACGGTTACGGGGGCTGATGGCTCTTATTCCTTCATCACGATCGT GCCGGGCGCCTATCCGGTCGTGGGGCTGCACAATGTCTGGCGCCCGCGCCACATCCATGTGTCGTTGTTCGGTCCGTCCTTCGTGACCCGCTTGGTTACCCAGATATATTTCGAGGGCGA TCCGCTGCTGAAATATGACACGATCTACAACACGGCGCCCGACATCTCGAAGCGCAGCATGGTGGCGCAGTTGGACATGGGCGCCACGCAATCCGAATGGGGCCTGACCTATCGCTTCGA CATCGTTCTGCGTGGGCGCAACGGCAGCTATTTCGAGGAACCCCATGACCACTAAGACCCCACTGACCATCACCCCCTCGCAGACTGTCGGGCCTTTCTATGCCTATTGCCTGACCCCGG AGGACTACGGGACGCTTCCACCGCTGTTCGGCGCGCAGCTTGCGACCGAGGACGCCGAAGGGGAACGGATTACGATCCAGGGAACGATCACGGACGGAGAGGGGGCCATGGTTCCCGATG CCTTGATCGAGATCTGGCAGCCGGACGGGCAGGGGCGTTTTGCTGGAGCCCATCCAGAGCTGCGGAATTCGGCCTTCAAGGGCTTCGGGCGCCGCCACTGTGACAAAAGCGGAAACTTCA GTTTCCAAACCGTGAAGCCTGGCCGGGTGCCCACTGCCGACGGCGTGATGCAGGCACCCCATATCGCTTTGTCGATCTTCGGCAAGGGATTGAACCGCCGGCTCTATACGCGGATCTACT TCGCAGACGAGGCATCGAATGCCGAGGACCCCGTTCTGTCGATGCTGTCCGAGGATGAGCGCGTGACCCTGATCGCCACCTCTGAATCGCCCGCCGCATATCGCCTCGACATCCGCCTGC AAGGCGACGGCGAAACGGTGTTTTTCGAGGCCTGAGTCGGCCGGCAAGTTTGCGGGGATCCGTCCGCCGCAATTGTGTTTCGCTATAGACGCCACGGCTGCCGCATGCCGCCGGGTGGAA GGGCCTTGCAAGGCCTGTCAACGGCGGAGTAAAATCCGGCCAGGCGGCGGAGTAAAACCAGGCCACTTGTGGCCCACGCATGAGACACCCGGGAGGGCGTAGCCCAAGCGGGGGTCTCAT GCGTGTGCGGCGGTTTTCTGGGGGTTCAGCCAGCCTTGCGGGCGCGGCTTTGAGCGAGACGATAGCTGTCGCCGTTCATCTCGAG

74 Hasonlóság CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGG CTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGC GGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAA GATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGC TGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGG TTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTC CCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTC CCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTT TATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTG ATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTA TTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATT GTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTG GCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAAC GTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTT ACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAG ATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTC GCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTA TTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCG ACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTG GCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGC AGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCG ATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGA ATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTC AGAACGCTCAATCAATCAGAATGTAATCTTGACATAGA ATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGT CCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCC CTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACG GTCTTCTCCGAACGGCGTTTTTTGGC a két szekvencia teljesen ugyanaz

75 Hasonlóság CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGG CTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGC GGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAA GATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGC TGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGG TTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTC CCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTC CCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTT TATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTG ATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTA TTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATT GTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTG GCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAAC GTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTT ACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAG ATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTC GCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTA TTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCG ACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTG GCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGC AGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCG ATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGA ATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTC AGAACGCTCAATCAATCAGAATGTAATCTTGACATAGA ATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGT CCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCC CTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACG GTCTTCTCCGAACGGCGTTTTTTGGC AAACTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGC GGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGG CCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGC AAAAGATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGG TTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGG GCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGA TGTCCCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCT GCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTG GCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATC CTGATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGG TTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTC ATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTG CTGGCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCC AACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGC TTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTC CAGATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATG TTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAAC CTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTT TCGACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCG GTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACG CGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAG GCGATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGG GGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAAT GTCAGAACGCTCAATCAATCAGAATGTAATCTTGACAT AGAATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCC CGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTC CGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCG CACGGTCTTCTCCGAACGGCGTTTTTTGGC GLOBÁLIS, LOKÁLIS Most is - majdnem BLASTN, FASTA

76 ANALÓGIÁK - ADATBANKOK Összahasonlítás már ismert elemekkel

77 … és kódol-e fehérjét? Open reading frames: nyitott leolvasási keretek Áltában ATG-vel kezdődik, de opció Hossz: ajánlás 100 aminosav, de opció Az eredmény hipotetikus, össze kell vetni a valósággal Hipotetikus fehérje lista  hasonlóság  BLASTP Információból információ generálása Problémák: frameshift mutáció, a globál hasonlóság csődje Hol kezdődik? Mi a start?

78 Egy régió nyitott leolvasási keret térképe

79 Hol kezdődik? Ki tudja? Egyéb elemek azonosítása, genomi elrendeződés Kísérletes ellenőrzés

80 FRAME SHIFT MUTÁCIÓ - MEGOLDÁS Minden leolvasásái keretben transzláció Stop kodon nem számít Mindent mindennel összehasonlít fehérje szinten BLASTX

81 In silico transzláció mind a 6 leolvasási keretben

82 Kodon felhasználás, codon usage Az élőlényekre jellemző a kodon felhasználási gyakoriság Kodon felhasználási táblázatok, adatbankok

83 Kodon felhasználás, codon usage

84 Kodon felhasználás, eltérések


Letölteni ppt "BIOINFORMATIKA INFORMATIKABIOINFORMATIKABIOLÓGIA “A valaha élt kutatók 99%-a kortársunk” Az adatokra is igaz  információs forradalom."

Hasonló előadás


Google Hirdetések