Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról.

Hasonló előadás


Az előadások a következő témára: "EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról."— Előadás másolata:

1 EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról RENDELKEZÉSRE ÁLLÓ VAGY SZÜKSÉGES INFORMÁCIÓK A KERESETT FEHÉRJÉRŐL, ILLETVE GÉNJÉRŐL - nem tudunk semmit csak fenotípus alapján jellemezhető mutagenezis (transzpozon) kromoszomális séta van tisztított fehérje fehérje funkció tesztelhető expressziós könyvtárak fehérje szekvenálás  DNS próba tervezés ellenanyag termeltetés expressziós könyvtárak már van ilyen fehérje illetve gén más típusú sejtekből heterológ próba használata könyvtárak átvizsgálásához

2 kolónia vagy plakkhibridizáció, jelölt DNS-sel DNS próba előállítása: - szintetikus (degenerált) oligonukleotidok - megfelelően választott primerekkel elôállított PCR fragment - izolált DNS fragment (lehet heterológ is) Jelölési módszerek - radioaktív vagy nemradioaktív - 5' foszforilálás, vagy 3' végen feltöltéses végjelölés vagy terminális transzferázzal, "nick-transzláció", "random priming", PCR POZITÍV KLÓNOK KÜLÖNBÖZŐ KÖNYVTÁRAKBÓL VALÓ KIVÁLASZTÁSÁRA SZOLGÁLÓ MÓDSZEREK honnan lehet próbánk: >a gén már ismert, legalábbis egy darabon > heterológ próba: más mikroorganizmusokból már ismert hasonló géne > van tiszított fehérjénk  fehérje szekvenálás  DNS próba tervezés reverz transzlációval

3

4 [gbbct]: 50 CDS's (13879 codons) Egy példa AmAcid Codon Number /1000 Fraction Gly GGG Gly GGA Gly GGT Gly GGC Glu GAG Glu GAA Asp GAT Asp GAC Val GTG Val GTA Val GTT Val GTC Ala GCG Ala GCA Ala GCT Ala GCC Arg AGG Arg AGA Ser AGT Ser AGC Lys AAG Lys AAA Asn AAT Asn AAC Met ATG Ile ATA Ile ATT Ile ATC Thr ACG Thr ACA Thr ACT Thr A CC Trp TGG End TGA Cys TGT Cys TGC End TAG End TAA Tyr TAT Tyr TAC Leu TTG Leu TTA Phe TTT Phe TTC Ser TCG Kodon felhasználási preferencia – táblázat

5 Lambda fág példák

6 - Immunológiai detektálás poli- vagy monoklonális ellenanyaggal - Aktivitás mérés (csak bizonyos szerencsés esetekben) - Valamilyen módon jelölt liganddal (ha van a keresett fehérjének) cDNS-ből készült expressziós könyvtárból

7 ÉLESZTŐ KÉT HIBRID RENDSZER fehérje-fehérje kölcsönhatáson alapuló szelekció GAL4 transzkripciós aktivátor aktivátor régió (AR)DNS kötő domén (DKD) lacZGAL4 kötő hely DKD Protein X Protein Y AR lacZGAL4 kötő hely DKD Protein X AR Protein Y kölcsönhatás esetén: kék telepek

8 BAKTERIÁLIS KÉT HIBRID RENDSZER lacZGAL4 kötő hely DKD Protein X Protein Y RNS pol. pozitív szelekció, nagyobb könyvtárakra GAL4 kötő hely his3 DKD Protein X RNS pol Protein Y lacZ DKD Protein X RNS pol Protein Y GAL4 kötő hely kölcsönhatás esetén: kék telepek kölcsönhatás esetén: növekedés hisztidin mentes táptalajon

9 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

10 RESTRIKCIÓS TÉRKÉPEZÉS

11 vektor Hasítás, A,B enzimekkel A B A B inszert ligálás Transzformálás, felszaporítás, tisztítás Hasítás, A,B enzimekkel AB A C Klónozás, szubklónozás

12 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

13 AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA

14 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

15 AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA TCH6-VEG (8691 bps) TCH6SK O20 O15 TCH64uni TCH6uni O16 TCH13T7 O12 X1UNI TCX52t7 TCH64sk O9 X1O5 TCX34t3 X1O1 X1O6 TCX54t3 X1O2 TCX66T3 TCX75t7 TCX81t3 X1O7 X1O4 X1O3 TCX81 TCX75T3 X1O8 O10 TCH5uni X1T3 O14 O13 TCB4T3 pTCX1 pTCB4/2 átfedő szekvenciákból, két szálon szekvenált régiókból kontig összerakás kék: szubklónozás, rózsaszín: primer séta

16 Új, újabb és legújabb korszak: Nagyáteresztőképességű technikák

17 17 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció DNS Gén transzkripció, RNS szerkesztés RNS degradáció fehérje transzláció, poszttranszlációs módosítás metabolomika

18 18 A BIOLÓGIAI INFORMÁCIÓ HORDOZÓ MEGFEJTÉSE GENOMIKA A teljes genetikai állomány szekvenciájának meghatározása, A szekvenciákon elhelyezkedő funkcionális régiók számítógépes jóslása: annotálás

19 19 Funkcionális genomika RNS szinten TRANSZKIPTOMIKA

20 Egy DNS chip kísérlet folyamatábrája

21 21 A chipek kiértékelése, eredménye

22 22 Funkcionális genomika fehérje szinten PROTEOMIKA

23 Proteomika EgyTipikus protokol Minta elő Izoelektromos fókuszálás SDS PAGE Láthatóvá tétel Kép analízis Protein pötty kivágás tömegspektrometria Protein azonosítás

24 24

25 25 Proteomika: az elválasztástól az azonosításig

26 Oligonukleotid szintézis Mintegy 50 éves múlt 5 különböző kémia: foszfáttriészter, fosztittriészter, foszfátdiészter Foszforamidit, H-foszfonát Szilárd fázisú szintézis: hordozó: controlled pore glass (CPG), vagy polisztirol Mind DNS mind RNS szintetizálható mind a két módszerrel

27 De ha sikerül, és van szekvenciánk Mi van rajta,van-e gén? Honnan tudjuk, hogy Valamit találtunk, találtunk-e gént? CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGA TCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGG TCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTT CGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAG GGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGC CGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGT CCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCA TTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCG AGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC GGGAATGCTTCGTGTTGAAGTGGCCCTGGCGCGCGCGCAGGCGGCAGAGGGCCTTGTCAGTTCGGAATTGGCCGACGCGATCGAGGTTGTTGGTACTGCCGGGTTGGACCCCGAGGCGAT GGCGGCGACTACTCGCATGACAGGAGTGCCCGCAATATCGTTCGTCCGTGCGGTGCAATCGGCCCTGCCGCCCTCACTGGCGGGTGGATTTCATTTCGGCGCCACCAGTCAAGACATCGT GGATACGGCCCACGCGCTCCAGCTGGCCGAGGCACTCGATATTATAGAAGTCGATTTACACGCCACTGTCAGCGCAATGATGAATCTGGCCGCTGCTCACTGCAATACACCCTGTATCGG GCGCACGGCCTTGCAGCACGCAGCGCCAGTTACGTTCGGCTACAAGGCGTCCGGCTGGTGCGTTGCCCTGGCGGAGCATCTGGTGCAGCTTCCCGCGCTGCGAAAGCGGGTTCTGGTGGC GTCGCTAGGGGGGCCGGTTGGTACCCTTGCCGCGATGGAGGAGCGGGCCGACGCTGTACTGGAGGGTTTCGCTGCGGACCTGGGGTTGGCCATTCCCGCCCTGGCCTGGCACACGCAGCG GGCCCGGATCGTCGAGGTGGCCAGTTGGCTGGCCATATTGCTGGGAATTCTGGCAAAAATGGCCACCGATGTCGTTCACTTGTCCTCCACGGAAGTGCGCGAGCTTTCCGAACCTGTAGC GCCGGGCAGGGGGGGCTCCTCGGCGATGCCTCACAAGCGGAACCCGATTTCCTCGATTACCATCCTGTCCCAGCATGCTGCGGCAGGGGCCCAGCTCTCCATTCTCGTGAACGGCATGGC CAGTCTGCACGAACGTCCGGTGGGGGCGTGGCATTCGGAATGGTTGGCTCTGCCGACGCTGTTCGGCCTTGCCGGCGGTGCCGTGCGCGAGGGCAGGTTTCTGGCCGAGGGGCTGCTGGT CGATGCCGACCAGATGGGTCGCAATCTACAATTGACCAATGGCCTGATTTTCAGCGACGCGGTAGCCGGCCAGTTGGCAAAGCACTTGGGTCGGGCCGAGGCTTATGCCGCTGTCGAGGA TGCCGCCGCCGAGGTGTTGCGTTCAGGCGGCAGCTTTCAGGGTCAGCTGAACCAGCGCCTGCCCGATCACCGCGACGCTATCGCTATTGCTTTTGATACGACGCCGGCGATCCAGGCCGG GGCCGCCCGCTGCCGTAGTGCGCTGGATCATGTGGCTCGTATTCTTGGACCCGCCTCTACCATCGGATTTCAAGGAGGCTAATGACGTGACGACACTGTTTGAGGCGACGACCATCCCGA TTTGCGAGGGCCCGCGCGACCAGACCGCCGAGATCCTTTTCGAGATGCCGCCGGGTGCGTGGGATACCCATTTTCATGTTTTTGGCCCAGTTTCATCGTTTCCATACGCAGAACACAGGC TCTATTCCCCACCGGAGTCGCCACTTGAGGATTATCTGGTGTTGATGGAGGCTTTGGGGATCGAGCGCGGCGTTTGTGTCCATCCGAATGTTCATGGTGCCGACAATTCGGTGACGCTCG ACGCAGTTGCGCGGTCCGATGGTCGTCTGCTGGCGGTGATCAAGCCACATCACGAGATGACTTTTGTTCAGCTGCGGGACATGAAGGCGCAGGGGGTCTGCGGGGTACGTTTTGCCTTCA ATCCGCAGCATGGCTCGGGCGAGTTGGATACTCGTTTGTTCGAGCGTATGTTGGACTGGTGCCGCGACCTAGGCTGGTGCGTAAAATTGCATTTCGCGCCCGCTGCGCTGGACGGTCTGG CTGAACGTTTGGCGCGCGTCGATATTCCGATCATCATCGATCATTTCGGGCGGGTGGACACCGCGCAAGGTGTGGATCAGCCGCACTTCCTGCGTTTGCTCGATCTGGCCAAACTGGACC ATGTCTGGATCAAGCTTACGGGGGCAGATCGTATTAGCGGTTCCGGCGCGCCATATGACGATGTCGTGCCCTTCGCGCACGCTTTGGCAGATGTGGCGCCCGACCGCCTCCTCTGGGGTT CGGATTGGCCGCATTCAGGCTATTTCGATCCGAAGCACATACCCAATGACGGCGACTTGTTGAACCTTTTGGCGCGTTTTGCCCCCGATGCTGAACTGCGTCGTAAGATCCTTGTGGACA ACCCGCAGCGCCTGTTCGGGGCTGCTTGAGGAGCCGAGCCGATGCAACCTTTCGTCTACGAAACAGCCCCAGCGCGCGTCGTTTTCGGGCGCGGCACTTCGCAGAATCTGCGGCGGGAAC TTGAGGCCCTGAATTTTGGCAGGGCGCTGGTTCTTTCCACGCCCGACCAAAAAGAACAATCGCTGCGAATTGCCCAGGGCCTGGGTTCTCAGCTGGCGGGGTCGTTCCACGCCGCTGCCA TGCATACGCCTGTCGAGGTCACCTTGCAGGCGCTTGAGGTGCTGAAGGATGTGCAGGCCGATTGCATCGTGGCGATTGGCGGCGGCTCAACCATTGGGTTGGGCAAGGCACTGGCCCTGC GCACCGATCTGCCGCAGATCGTCGTCCCGACGACTTATGCCGGCTCGGAAATGACGCCGATCCTGGGAGAGACGGAAAACGGGCTGAAGACCACACAGCGTAATCCCAAAGTGCAGCCGA GGGTGGTTCTCTACGATGTGGACCTGACTGTGACGCTTCCGGTGCAGGCCTCGGTTACATCAGGCATGAATGCGATCGCCCATGCGGCCGAGGCATTATATGCGCGGGACGGCAATCCGG TGATCTCGCTGATGGCCGAAGAGGCGATCCGCGCGCTGGCCCATGCCCTGCCGCGTATCGTTGCCACTCCCGACGATATCGAAGCGCGCAGCGATGCCCTCTATGGCGCGTGGCTGTGCG GAACGTGCCTGGGTTCGGCCGGAATGGCGTTGCACCATAAGCTCTGCCACACCCTCGGCGGAAGTTTCGATTTGCCACATGCCCCGACCCACACGGTCATCCTCCCCTATGCGCTCGCCT ATAATAGTGATGCGGCCAGGCCCGCAATGGCAGCCATCGCGCGCGCGCTGGGCATGGCGGATGCAGCGATGGGCATGAGAGCGTTGTCCATGCGGTTGGGCGCCCCGACATCGCTGCGTG AGTTGGGCATGGCAGAAGCCGATCTTGACCGCGCCGCCGACCTGGCCACGCAAAATGCCTATTGGAACCCGCGACCCATCGAGCATGGGCCGATTCGTAACCTTCTGGGACGGGCCTGGG CTGGAACTCCGGTCTGAAGGACCTAGAGGACAGTCAATTCATTGATCTGAAGTCACCAACGAGGAGATATGGGATGAACGAGAACATTGCGATCCGCAAATTGGGCCGCCGACTCCGATT GGGCATTGCCGGTGGCGCGGGTCATTCGCTGATTGGTCCGGTTCACCGGGAGGCGGCTCGGCTTGACGATTTGTTCTCTCTCGATGCTGCGGTGCTGTCCAGTAACGCGGAACGCGGGGA TGCTGAGGCCGCGGCTCTCGGAATTCCGCGCTCCTATTCGTCCACCGCCGAGATGTTCGCAATGGAGAAGGCTAGGCCCGACGGTATTGAGGCCGTTGCCATAGCCACGCCGAATGACAG CCATTACCGGATTCTGTGCGAGGCGCTGGACGCCGGGTTGCATGTAATCTGCGACAAGCCTTTAACCTCCACGAAGGCCGAGGCCGACGACGTGCTGGTGCGGGCGAAGGCCGCGGGCAA GGTTGTGGTCCTGACCCACAATTATTCTGGCTACGCCATGGTACGCCAAGCCCGCGCCATGGTCGCCGCCGGTGAACTTGGGAAAATCCACCAGATTCACGGGGTCTACGCTCTGGGCCA GATGGGCCGTTTGTTCGAGGCCGACGAAGGGGGCGTGCCTCCGGGGATGCGTTGGCGGATTGATCCTGCGCGCGGTGGCGACAGTCACGCCCTGGTGGATATCGGCACCCATGTGCACCA TCTGGCTACCTTCATCACGCAGTTACAGGTCGTTGAGGTAATGGCCGATCTTGGGCCGGCGGTTCAAGGCCGCGCGGCCCATGACAGTGCCAACGTCATGTTCCGTATGGAAAACGGAGC TTTCGGATCGTTCTGGGCCACCAAGGCGGCATCGGGGGCCAGCAAGCTGGCGATCGAAGTCTACGGTGACAAGGGCGGCGTCCTGTGGGAGCAGGCCGACGCCAATAACTTGCTACATAT GCGGCAGGGCCAACCCCCAGCCCTGATTGGTCGACAAGTTGCCGGGCTGCATCCTGCGGCAATCCGCGCGATGCGGGGGCCGGGTTATCATTTCGTGGAAGGCTATCGCGAGGCCTTTGC GAATATGTACGTGGATTTCGCCGAACAGATCTTGGCCATGATGGGCAAGGGGGCCGCAGATCACCTGGCATTGGAAGCGCCGTCGGTCGTGGACGGCCTGCGCTCCATGGCGTTCATCGA AGCCTGTGTGGCGTCGTCGCAGGACCGCCAATGGCGGCAGGTGGAGCAAGTCAGTTGATCTCTCAGCGGCTTCGGCATTTTTCCCGGGCTGGCGGCTCCCCGCAGCTCCCTCCGGTGGAA AGAACGGGTAATCAAAATAATATTCTGATTTTAAAGGATGTTCCAGACAGCTGATTATTCCTGAAATTTAGGGCTCTTTCGGCTGTAGCAATTGACTAAAAGCCGAATTTAAGGGTAA TTAAACAAACGCTGTTCGTATTATTTAAACAGGTGAGTGATGGCGATATTCCTGGAAGGCTGGCCGATGGTTTCATCTGAATACCCGGCCAGAAGCGTTGAGGCGCACCCGGCCTATCTG AC GCCAGACTATGTTTTCACGCGAAAGCGTGCGCCGACTCGACCGCTGCGGTTAATTCCTCAGTCTGCGACGGAGCTGTATGGCCCGGTTTATGGACAAGAGAGCGTCCGTCCGGGGGATAA CGACCTGACCCGTCAGCACGAAGCTGAGCCGGTGGGGGAGCGGATTCTGGTGACGGGGCGCGTGACCGACGAAGACGGGCGGGGTGTCCCTAATACGCTGCTAGAGATCTGGCAGGCCAA TGCCGCCGGTCGCTATATCCACAAGCTTGACCAGCATCTTGCCCCGCTTGATCCAAATTTCTCGGGGGCAGGGCGTACGGTTACGGGGGCTGATGGCTCTTATTCCTTCATCACGATCGT GCCGGGCGCCTATCCGGTCGTGGGGCTGCACAATGTCTGGCGCCCGCGCCACATCCATGTGTCGTTGTTCGGTCCGTCCTTCGTGACCCGCTTGGTTACCCAGATATATTTCGAGGGCGA TCCGCTGCTGAAATATGACACGATCTACAACACGGCGCCCGACATCTCGAAGCGCAGCATGGTGGCGCAGTTGGACATGGGCGCCACGCAATCCGAATGGGGCCTGACCTATCGCTTCGA CATCGTTCTGCGTGGGCGCAACGGCAGCTATTTCGAGGAACCCCATGACCACTAAGACCCCACTGACCATCACCCCCTCGCAGACTGTCGGGCCTTTCTATGCCTATTGCCTGACCCCGG AGGACTACGGGACGCTTCCACCGCTGTTCGGCGCGCAGCTTGCGACCGAGGACGCCGAAGGGGAACGGATTACGATCCAGGGAACGATCACGGACGGAGAGGGGGCCATGGTTCCCGATG CCTTGATCGAGATCTGGCAGCCGGACGGGCAGGGGCGTTTTGCTGGAGCCCATCCAGAGCTGCGGAATTCGGCCTTCAAGGGCTTCGGGCGCCGCCACTGTGACAAAAGCGGAAACTTCA GTTTCCAAACCGTGAAGCCTGGCCGGGTGCCCACTGCCGACGGCGTGATGCAGGCACCCCATATCGCTTTGTCGATCTTCGGCAAGGGATTGAACCGCCGGCTCTATACGCGGATCTACT TCGCAGACGAGGCATCGAATGCCGAGGACCCCGTTCTGTCGATGCTGTCCGAGGATGAGCGCGTGACCCTGATCGCCACCTCTGAATCGCCCGCCGCATATCGCCTCGACATCCGCCTGC AAGGCGACGGCGAAACGGTGTTTTTCGAGGCCTGAGTCGGCCGGCAAGTTTGCGGGGATCCGTCCGCCGCAATTGTGTTTCGCTATAGACGCCACGGCTGCCGCATGCCGCCGGGTGGAA GGGCCTTGCAAGGCCTGTCAACGGCGGAGTAAAATCCGGCCAGGCGGCGGAGTAAAACCAGGCCACTTGTGGCCCACGCATGAGACACCCGGGAGGGCGTAGCCCAAGCGGGGGTCTCAT GCGTGTGCGGCGGTTTTCTGGGGGTTCAGCCAGCCTTGCGGGCGCGGCTTTGAGCGAGACGATAGCTGTCGCCGTTCATCTCGAG

28 1. DNS szekvencia homológia alapján Adatbankok, FASTA, BLAST 2. ORF KERESÉS, Általában ATG-vel kezdődő szakaszokat keresünk, amelyek ésszerűen hosszúak (100 aminosav) Clone ManagerClone Manager 3. A kapott ORF-k homológia kutatása Adatbankok, FASTA, BLAST HONNAN LEHET TUDNI, HOGY GÉNT TALÁLTUNK?

29 Fehérjeszekvenciák összehasonlítása

30 4. Ha rendelkezésre áll a keresett fehérjének N-terminális szekvenciája, akkor az azzal való összevetés 5. Funkcionális analízis - a kapott polipeptidet expressziós kazettába illesztjük, és a kapott termék aktivitását teszteljük - mutáns törzs komplementáció ja az expressziós kazettában termeltetett fehérjével 5. Immunológiai teszt Expressziós kazettában termelt fehérjét a tisztított fehérje ellen termeltetett ellenanyaggal, Western blot-tal analizálunk 6. Bakteriális gének esetén a T7 RNS polimeráz alapú rendszerekkel 7. Transzkriptomika 8. Proteomika HONNAN LEHET TUDNI, HOGY GÉNT TALÁLTUNK?


Letölteni ppt "EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról."

Hasonló előadás


Google Hirdetések