Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

1 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK Három fő csoport 1970 – A molekuláris biológia forradalmának kezdete.

Hasonló előadás


Az előadások a következő témára: "1 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK Három fő csoport 1970 – A molekuláris biológia forradalmának kezdete."— Előadás másolata:

1 1 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK Három fő csoport 1970 – A molekuláris biológia forradalmának kezdete A Haemophilus influenzae restrikciós endunuklázának felfedezése I típus Specifikus szekvenicákat ismer fel, de elvándorol a DNS-en (~ bázis) mielőtt az egyik szálat elhasítja, nukleotideokat szabadít fel (~75) a hasítás helyén. Egy másik endonuckleáz kell a második szál hasításához Pl. EcoK. Mg2+, ATP és SAM (S-adenosyl methionine) SAM kell hozzá

2 2 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK II típus Speciális célszekvenciát ismer fel és hasítja a DNS-t mindkét szálon a felismerési szekvenciában vagy annak környezetében pl. EcoRI Mg2+ kell Ez a típus az elterjedt III. típus I és II. Kombinációja. Mindkét DNS szálat hasítja egy meghatározott távolságra a felismerési szekvenciától plHgaI Mg2+-t ésATP-t igényel

3 3 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK EnzimFelismerőhely hossza Felismerő-hasítóhely Forrás organizmus AluI4 AG/CTArthrobacter luteus HphI5 GGTGAN 8 /Haemophilus parahaemolyticus EcoRI6 G/AATTCEscherichia coli BamHI6 G/GATCCBacillus amyloliquefaciens Ragadós végeket adó hasítások (sticky end) 5' túlnyúló SalI6Streptomyces albis 3' túlnyúló KpnI6Klebsiela pneumonia Tompa végű hasítások (blunt end) HaeIII4Haemophilus aegyptus 5' G TCGAC 3' 3' CAGCT G 3' 5' GGTAC C 3' 3' C CATGG 5' 5' GG CC 3' 3' CC GG 5'

4 4 Palindrom példák KIS EREK MENTÉN LÁP SÍK ÖLÉN ODA VAN A BÁNYA RABJA JAJ BARANYÁBAN A VADON ÉLŐ KIS PÁLNÉT NEM KERESIK

5 5 Isoschisomers AtcI6 5' GGTAC/C 3' KpnI 5' GGTAC/C 3' XmaI6 5' C/CCGGG 3' SmaI 5' CCC/GGG 3' Kompatibilis véget adó enzimek SalI6 5' G/TCGAC 3' XhoI 5' C/TCGAG 3' FEHÉRJE TÚLTERMELTETÉS SZEMPONTJÁBÓL KITÜNTETT ENZIMEK AflIII6 5' A/CPuPyGT 3' BspHI6 5' T/CATGA 3' NcoI6 5' C/CATGG 3' NdeI6 5' CA/TATG 3'

6 6 DNS METILÁZOK - dam metiláz (dezoxiadenin metiláz) 5’ GATC 3’ felismerő hely N 6 pozícióban metilez adenin sok dam metiláz érzékeny enzim van pl. MboI, XhoI, egyenként ellenőrizni kell, érzékenység esetén - dam - törzs használata - nem érzékeny izoskizomer használata (ha van) (MboI - Sau3AI)

7 7 -dcm metiláz (dezoxicitozin metiláz) 5’ CCAGG 3’ vagy 5’ CCTGG 3’, C 5 pozícióban metilez citozin - hasonlóképpen léteznek dcm metiláz érzékeny enzimek - megoldás ugyanaz, mint a dam esetén Sok metiláz van még, hasonló felismerő kanonikus szekvenciával, mint a restrikciós enzimek pl. M. EcoRI metiláz

8 8 Polimerázok - DNS függő DNS polimerázok - RNS függő DNS polimerázok - Templátfüggetlen DNS polimeráz - DNS függő RNS polimeráz 5’  3’ polimeráz aktivitás

9 9 DNS függő DNS polimerázok

10 10

11 11 DNS jelölés, nick transzláció

12 12

13 13 Templát független DNS polimeráz

14 14 RNS függő DNS polimeráz

15 15 A ligáz csak 5’ foszfát – 3’ OH végeket tud összekapcsolni, ha a vektort defoszforiláljuk, nem tud önligálódni

16 16 DNS ELVÁLASZTÁSA ELEKTROFORÉZIS denaturáló nem-denaturáló lúgos, (DNS, agaróz) formaldehid, glioxál, DMSO (RNS, agaróz) urea (DNS, akrilamid) méret > 50 kb 100bp-50 kb < 1000 bp Mátrix agaróz agaróz % poliakrilamid technika pulzáló gélelektroforézis hagyományos gélelektroforézis (5-20%) hagyományos LÁTHATÓVÁ TÉTEL: etídium bromid, interkaláló festék  nem-denturáló körülmények, első ősorban duplaszálú DNS-t fest, de egyszálú nukleinsavakat is. A DNS 254 nm-en elnyel  energia a festékre  590 nm-en emisszió, a festék maga 302 és 366 nm-en nyel el Lehet gélbe rakni, utófesteni, illetve a mintához adni. Érzékenység kb 10 ng. Egyéb festékek, fluoreszkáló anyagok: pl. fluoreszcein, minden körülményközött radioaktivitás: minden körülmény között, 35 S, 33 P, 32 P beta sugárzók Nincs roncsoló ágens

17 17 Horizontális gélelektroforézis

18 18 DNS IZOLÁLÁSA GÉLBŐL - közös pont: először elektroforetikus úton elválasztjuk a DNS-t - a megfelelő sávot kivágjuk steril pengével AGARÓZ - dialízis, dializáló hártyában, elektrodialízis a kapott DNS további tisztítása fenolos extrakcióval, alkoholos kicsapással, univerzális, széles mérettartomány - - fagyasztásos módszer : a kivágott – DNS-t tartalmazó - agarózdarabot –80 o C-on megfagyasztjuk az agarós szerkezete roncsolódik, ebből a DNS egy szűrőn keresztül centrifugálással kinyerhető további tisztítás szükséges, univerzális - kromatográfiás módszerek 6M NaI mellett a DNS 55 o C-on (az agaróz megolvad) szilikagél felületére kötődik, a mátrix mosása után innen o 55 C-on alacsony só(víz, TE) eluálható, majdnem univerzális, elég széles mérettartomány DEAE membránba futtatjuk a DNS-t, innen magassókoncentrációval (1.5M) magas hőmérsékleten eluálható nagy tisztaság, szűk, alacsony mérettartomány < 1.5 – 2 kb esetén jó a kitermelés POLIAKRILAMID (PAGE) a kivágott darabot passzív módon vagy elektromos térben eluáljuk majd töményítjük, ioncserésen tisztítjuk

19 19 Klónozás fogalma Egy általunk kiválasztott DNS darabot vektor segítségével gazdasejtbe juttatunk és ott felszaporítunk Szubklónozás: további kisebb darabok hasonló felszaporítása vektor Hasítás, A,B enzimekkel A A B B inszert ligálás Transzformálás, felszaporítás, tisztítás Vektor: olyan nukleinsav hordozó, amellyel nukleinsavakat sejtbe lehet juttatni, Felhasználás: klónozás, fehérje termeltetés, genetikai manipulációk stb. Hasítás, A,B enzimekkel

20 20 Figure 20.2 Bacterium Bacterial chromosome Plasmid Cell containing gene of interest Recombinant DNA (plasmid) Gene of interest DNA of chromosome Recombinate bacterium Protein harvested Basic research on protein Gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hormone treats stunted growth Protein expressed by gene of interest 3

21 21 KÓNOZÁSBAN ÁLTALÁNOSAN HASZNÁLT VEKTORTÍPUSOK példa inszert méret plazmidokpUC18,19< kb fonalas fágokmp18, 19< kb fagemidekpBluescriptKS, SK±< kb fágokEMBL3,4 néhányszor 10 kb kozmidokpHC79 néhányszor 10 kb PLAZMIDOK replikációs origo ORI rezisztencia marker Cirkuláris kettősszálú extrakromoszómális elemek BAC, YAC néhány 100 kb pBAC108L, pYAC3 BAC, YAC: bacterial, yeast artificial chromosome

22 22

23 23 Egy ősi plazmid: pBR322

24 24 Magas kópiaszámú változat: pUC19

25 25 Inszertet tartalmazó klónok kiválasztása -antibiotikum rezisztencia, ld. pBR3222, két antibiotikum, az egyik elromlik, ha inszert épül be, fáradtságos szurkálások, két antibiotikum rezisztencia gén szükséges - kolónia hibridizáció, univerzális mindig használható - plazmid tisztítás, térképezés restrikciós emésztéssel hosszú fáradtságos - polimeráz láncreakció sejteken, kombinatorikus gyors ha nincs más szelekció - kék fehér színszelekció, - pozitív szelekciós vektorok, kondicionálisan letális gén a vektoron, az inszert beépül, elrontja a gént  megszűnik a letalitás - auxotrofiát komplementáló génbe történő klónozás ugyanaz a probléma, mint az antibiotikumok esetén

26 26 Kolónia hibridizáció

27 27 LacZ  komplementáció F' plazmidon: defektív  - galaktozidáz gén, hiányzik aminosav közötti régió bevitt vektor: tartalmazza a lacZ szabályozó régiót és az aminosavat a kettő együtt: aktív  – galaktozidáz  X-gal szubsztráttal kék telep a bevitt N-terminális fragmentben : polilinker régió (leolvasási keret marad) ebbe lehet klónozni fragmentumot, ha kis fragmentum és leolvasási keret nem romlik el  X-gal szubsztráttal kék telep, ha elromlik vagy nagy fragment  X-gal szubsztráttal fehér telep

28 28 PLAZMIDOK SEJTBE JUTTATÁSÁNAK MÓDJAI 1. Kémiai transzformálás Kompetens sejt: a DNS felvételére alkalmassá tett sejt A sejteket felnövesztés után centrifugáljuk speciális kétértékű kationokat (Ca2+, Mn2+) tartalmazó oldattal kezeljük, sejtfal permeabilitást növelő ágenst (DMSO) adunk hozzá transzformációs hatékonyság: transzformáns /µg DNS elvi szám a transzformációt  1 ng mennyiségű DNS-sel hajtjuk végre : normál érték: 10 6 – 10 8 nagyon jó: 10 9 a transzformáció hatékonyságát meghatározó tényezők: -oldatok edények tisztasága, - sejtek növekedési sebessége, a növesztés fázisa, hőmérséklete - hősokk hőmérséklete hossza - permeabilizáló faktor a lineáris DNS transzformációs gyakorisága kb 2 nagyságrenddel alacsonyabb, mint a cirkulárisé egyéb fogások: -spheroplast készítés ozmotikum jelenlétében és ezt transzformáljuk - a DNS-t liposzómába csomagoljuk transzfomálás előtt

29 29 Elektroporáció A sejteket felnövesztés után kis vezetőképességű, glicerines (nagy ellenállású  600  ) pufferben szuszpendáljuk nagy feszültségű impulzust adunk rá kb 5 ms-ig transzformációs hatékonység x jobb (10 10 /µg DNS) sejttípusonként optimalizálni kell maghatározó faktorok: - az oldat ellenállása - az impulzus nagysága, hossza - permeabilizáló, redox potenciált befolyásoló faktorok adagolása

30 30 A fágok általános felépítése  genetikai anyag: kb duplaszálú lineáris DNS  fertőzéssel jut a sejtbe,  nagy hatékonyság  két életciklus: - lizogén: a fág genetikai anyaga beépül a kromoszómába, a sejt túlél - lítikus: érett fág képződése során a sejtek lizálnak elpusztulnak  a végeken ragadós. ún. ’cos’ végek bal kar 20 kb centrális régió 14 kb jobb kar 9 kb cos a középső, centrális régió eltávolítható EcoRI BamHI SalI EcoRI BamHI SalI cos

31 31

32 32 Speciális λ fág fajták

33 33 Mesterséges kromoszómák: BAC (bacterial artificial chromosome) vektorok

34 34 Mesterséges kromoszómák: YAC (yeast artificial chromosome) vektorok

35 35 KÖNYVTÁRAK TÍPUSAI - genomiális a teljes genomból készül, elvileg minden információt tartalmaz (pl. nem transzlálódó régió, szabályozó régiók, intronok) mind prokariótákból, mind eukariótákból - cDNS az aktívan termelődő mRNS-ekből készül csak az érett mRNS szekvenciáját tartalmazza (nincs intron szabályozó régió stb) csak eukariótákból expressziós a cDNS-eket ún. expressziós kazettába klónozzuk, ezáltal a kódolt fehérje (ha a mRNS kódol ilyet) aktívan termelődhet Követelmények a könyvtárakkal szemben - fedje le a teljes genomot, illetve mRNS populációt - ne legyen redundáns

36 36 konkatamer in vitro pakolás: összekeverés fágfehérje extraktummal GENOMIÁLIS KÖNYVTÁR KÉSZÍTÉSÉNEK SÉMÁJA bal kar jobb kar bal karjobb kar centrális régió hasító helyek emésztés részleges vagy kb méretű teljes emésztés fragmentek ligálás A pakolódás feltétele, hogy a rekombináns gemon mérete a vad típus méretének 79 – 105 %- a lehet.

37 37 cDNS könyvtár A mRNS-ekkel szemben támasztott követelmények  Integritás  A mRNS mérete, degradált-e Megoldás: denaturáló gélelektroforézis (várt méret kb, a többség kb)  Lehet-e teljes hosszúságú cDNS-t szintetizáltatni Megoldás: elõzetes reverz transzkripció jelölt nukloetidokkal elektroforézis  Lehet-e nagy molekulasúlyú fehérjéket in vitro szintetizálni Megoldás: in vitro transzláció jelölt aminosavakkal  A kérdéseses fehérjét tudjuk-e szintetizáltatni Megoldás: in vitro transzláció + immunoprecipitáció

38 38 cDNS-könyvtár készítése primer adapter módszerrel

39 39 EGYÉB pl. ha a fehérje szabályozása ismert  szubsztraktív hibridizáció - számítógép, adatbankok genom szekvenálások - ismeretek a fehérje funkciójáról RENDELKEZÉSRE ÁLLÓ VAGY SZÜKSÉGES INFORMÁCIÓK A KERESETT FEHÉRJÉRŐL, ILLETVE GÉNJÉRŐL - nem tudunk semmit csak fenotípus alapján jellemezhető mutagenezis (transzpozon) kromoszomális séta van tisztított fehérje fehérje funkció tesztelhető expressziós könyvtárak fehérje szekvenálás  DNS próba tervezés ellenanyag termeltetés expressziós könyvtárak már van ilyen fehérje illetve gén más típusú sejtekből heterológ próba használata könyvtárak átvizsgálásához

40 40 A könyvtárakból kapott klónok általában túl nagyok közvetlen felhasználáshoz, ezért további munkálatok szükségesek: 1. AZ INSZERT RESTRIKCIÓS TÉRKÉPEZÉSE 2. A TÉRKÉP ALAPJÁN AZ INSZERT KISEBB DARABOKBAN TÖRTÉNŐ SZUBKLÓNOZÁSA 3. AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 4. AZ INSZERT SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA 5. SZÁMÍTÓGÉPES ADATFELDOLGOZÁS A SZEKVENCIÁN BELÜLI GÉNEK, ELEMEK AZONOSÍTÁSA A POZITÍV KLÓNOK TOVÁBBI FELDOLGOZÁSA

41 41 RESTRIKCIÓS TÉRKÉPEZÉS

42 42 vektor Hasítás, A,B enzimekkel A B A B inszert ligálás Transzformálás, felszaporítás, tisztítás Hasítás, A,B enzimekkel AB A C Klónozás, szubklónozás

43 43 AZ SZUBKLÓNOK SZEKVENCIÁJÁNAK MEGÁLLAPÍTÁSA

44 44 FEHÉRJE TERMELTETŐ RENDSZEREK PROKARIÓTÁK E. coli ismert, Bármilyen fehérje, feltéve, ha - nem túl nagy - nem túl kicsi - nem túl hidrofób - nincs túl sok cisztein benne szekréciós rendszere minimális Bacillus subtilis jól ismert, ha nem is annyira, mint az E. coli van szekréciós rendszere EUKARIÓTÁK élesztő gyorsan szaporodó eukarióta sejtvonal, sok ismeretanyag viszonylag könnyű kezelhetőség poszttranszlációs modifikációk lehetősége emlős sejtvonalak  minden fajta fehérje termeltethető bennük  tranziens expressziós rendszerek viszonylag gyors, de korlátozott lehetôségek,  stabil expressziós rendszerek  hosszú, fáradságos optimalizálást igényel

45 45 PROKARIÓTA EXPRESSZIÓS VEKTOR ELEMEI TT SZF SDkódoló szekvencia Pr TSZE TTGACAN 17 TATAAT 5’ UAAGGAGGN (3-11) START kodon AUG GUG UUG STOP kodon UAAU UGA UAG ARORI  GS Pr: promóter TT: transzkripciós terminációs szignál, SZF: szabályozó fehérje,, TSZE: transzlációt szabályozó elemek, SD: Shine-Dalgarno szekvencia, AR: antibiotikum rezisztencia, ORI: replikációs origo GS: gazdasejt

46 46 - Immunológiai detektálás poli- vagy monoklonális ellenanyaggal - Aktivitás mérés (csak bizonyos szerencsés esetekben) - Valamilyen módon jelölt liganddal (ha van a keresett fehérjének) cDNS-ből készült expressziós könyvtárból

47 47 Polimeráz láncreakció I. Termostabil DNS polimeráz, Taq, Pfu, Vent, Pwo stb. Soknak nincs 3’  5’ exonukleáz aktivitása  “A” túlnyúló

48 48 Polimeráz láncreakció II.

49 49 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI I. - FERTŐZÉSEK KIMUTATÁSA minden élőlény genetikai anyaga nukleinsav, ez tartalmaz specifikus szekvenciaelemeket  speciálisan tervezett primerek segítségével PCR a termék megjelenése fertőzésre utal

50 50 Figure 20.9a, b Normal  -globin allele Sickle-cell mutant  -globin allele 175 bp 201 bpLarge fragment DdeI 376 bp Large fragment DdeI restriction sites in normal and sickle-cell alleles of  -globin gene. Electrophoresis of restriction fragments from normal and sickle-cell alleles. Normal allele Sickle-cell allele Large fragment 201 bp 175 bp 376 bp (a) (b) Pontmutációk kimutatása RFLP-vel. Rerstrikciós fragment length polimorfizmus

51 51 A PCR DIAGNOSZTIKAI ALKALMAZÁSAI II. MUTÁCIÓK KIMUTATÁSA A normális C gén mutáns 5'3' A C 5'5' A5'5' PCR egészséges nincs termék beteg A C 5'5' 3' C5'5' PCR egészséges nincs termék beteg

52 52 transzkriptomika proteomika biokémiai aktivitás metabolikus útvonalak Centrális dogma és a bioinformatika főbb területei a molekuláris biológiában degradáció DNS Gén transzkripció, RNS szerkesztés RNS degradáció fehérje transzláció, poszttranszlációs módosítás metabolomika

53 53 Genom szekvenálási stratégiák Shotgun Primerséta

54 54 Alternatív shotgun stratégiák térképezés: -genetikai:gének,tulajdonságok pozícionálása -fizikai:szekvenciák,gének rendeződése

55 55 Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Genetic (linkage) mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) Physical mapping Ordering of large over- lapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the com- plete genome sequence Chromosome bands Genes located by FISH Genetic markers Overlapping fragments …GACTTCATCGGTATCGAACT… Figure Genom térképezés fajtái

56 56 Staining techniques used to produce chromosome banding patterns TechniqueProcedureBanding pattern G-banding Mild proteolysis followed by staining with GiemsaDark bands are AT-rich Pale bands are GC-rich R-banding Heat denaturation followed by staining with GiemsaDark bands are GC-rich Pale bands are AT-rich Q-banding Stain with quinacrine Dark bands are AT-rich Pale bands are GC-rich C-bandingDenature with barium hydroxide and Dark bands contain constitutive then stain with Giemsaheterochromatin A gének eloszlása nem egyenletes

57 57 Southern blot és hibridizáció

58 58 RestrikciósfingerprintRepetívDNSfingerprint KlónozottDNS fragmentumok STS: sequence tagged site egyedi bp fragment EST: expressed sequence tag

59 59 Bakteriális shot-gun könyvtár készítése kromoszómális DNS nebulizátor összetört DNS végek tompítása Preparatív gél elektroforézis 2-3,5 kb fragmentek defoszforilálás transzformáláselektroporálás E. coli

60 60 szekvenciaanalízis ellenőrzés, validáció Vektor és egyéb szennyező szekvenciák eltávolítása Gyenge minőségű szekvenciák eltávolítása Átfedő fragmentumokból kontigok összerakása A szekvenciák feldolgozása Phrap Vector_clipping Phred SeqMan/DNASTAR STADEN programcsomag

61 61 De ha sikerül, és van szekvenciánk Mi van rajta,van-e gén? Honnan tudjuk, hogy Valamit találtunk, találtunk-e gént? CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGA TCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGG TCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTT CGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAG GGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGC CGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGT CCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCA TTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCG AGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC GGGAATGCTTCGTGTTGAAGTGGCCCTGGCGCGCGCGCAGGCGGCAGAGGGCCTTGTCAGTTCGGAATTGGCCGACGCGATCGAGGTTGTTGGTACTGCCGGGTTGGACCCCGAGGCGAT GGCGGCGACTACTCGCATGACAGGAGTGCCCGCAATATCGTTCGTCCGTGCGGTGCAATCGGCCCTGCCGCCCTCACTGGCGGGTGGATTTCATTTCGGCGCCACCAGTCAAGACATCGT GGATACGGCCCACGCGCTCCAGCTGGCCGAGGCACTCGATATTATAGAAGTCGATTTACACGCCACTGTCAGCGCAATGATGAATCTGGCCGCTGCTCACTGCAATACACCCTGTATCGG GCGCACGGCCTTGCAGCACGCAGCGCCAGTTACGTTCGGCTACAAGGCGTCCGGCTGGTGCGTTGCCCTGGCGGAGCATCTGGTGCAGCTTCCCGCGCTGCGAAAGCGGGTTCTGGTGGC GTCGCTAGGGGGGCCGGTTGGTACCCTTGCCGCGATGGAGGAGCGGGCCGACGCTGTACTGGAGGGTTTCGCTGCGGACCTGGGGTTGGCCATTCCCGCCCTGGCCTGGCACACGCAGCG GGCCCGGATCGTCGAGGTGGCCAGTTGGCTGGCCATATTGCTGGGAATTCTGGCAAAAATGGCCACCGATGTCGTTCACTTGTCCTCCACGGAAGTGCGCGAGCTTTCCGAACCTGTAGC GCCGGGCAGGGGGGGCTCCTCGGCGATGCCTCACAAGCGGAACCCGATTTCCTCGATTACCATCCTGTCCCAGCATGCTGCGGCAGGGGCCCAGCTCTCCATTCTCGTGAACGGCATGGC CAGTCTGCACGAACGTCCGGTGGGGGCGTGGCATTCGGAATGGTTGGCTCTGCCGACGCTGTTCGGCCTTGCCGGCGGTGCCGTGCGCGAGGGCAGGTTTCTGGCCGAGGGGCTGCTGGT CGATGCCGACCAGATGGGTCGCAATCTACAATTGACCAATGGCCTGATTTTCAGCGACGCGGTAGCCGGCCAGTTGGCAAAGCACTTGGGTCGGGCCGAGGCTTATGCCGCTGTCGAGGA TGCCGCCGCCGAGGTGTTGCGTTCAGGCGGCAGCTTTCAGGGTCAGCTGAACCAGCGCCTGCCCGATCACCGCGACGCTATCGCTATTGCTTTTGATACGACGCCGGCGATCCAGGCCGG GGCCGCCCGCTGCCGTAGTGCGCTGGATCATGTGGCTCGTATTCTTGGACCCGCCTCTACCATCGGATTTCAAGGAGGCTAATGACGTGACGACACTGTTTGAGGCGACGACCATCCCGA TTTGCGAGGGCCCGCGCGACCAGACCGCCGAGATCCTTTTCGAGATGCCGCCGGGTGCGTGGGATACCCATTTTCATGTTTTTGGCCCAGTTTCATCGTTTCCATACGCAGAACACAGGC TCTATTCCCCACCGGAGTCGCCACTTGAGGATTATCTGGTGTTGATGGAGGCTTTGGGGATCGAGCGCGGCGTTTGTGTCCATCCGAATGTTCATGGTGCCGACAATTCGGTGACGCTCG ACGCAGTTGCGCGGTCCGATGGTCGTCTGCTGGCGGTGATCAAGCCACATCACGAGATGACTTTTGTTCAGCTGCGGGACATGAAGGCGCAGGGGGTCTGCGGGGTACGTTTTGCCTTCA ATCCGCAGCATGGCTCGGGCGAGTTGGATACTCGTTTGTTCGAGCGTATGTTGGACTGGTGCCGCGACCTAGGCTGGTGCGTAAAATTGCATTTCGCGCCCGCTGCGCTGGACGGTCTGG CTGAACGTTTGGCGCGCGTCGATATTCCGATCATCATCGATCATTTCGGGCGGGTGGACACCGCGCAAGGTGTGGATCAGCCGCACTTCCTGCGTTTGCTCGATCTGGCCAAACTGGACC ATGTCTGGATCAAGCTTACGGGGGCAGATCGTATTAGCGGTTCCGGCGCGCCATATGACGATGTCGTGCCCTTCGCGCACGCTTTGGCAGATGTGGCGCCCGACCGCCTCCTCTGGGGTT CGGATTGGCCGCATTCAGGCTATTTCGATCCGAAGCACATACCCAATGACGGCGACTTGTTGAACCTTTTGGCGCGTTTTGCCCCCGATGCTGAACTGCGTCGTAAGATCCTTGTGGACA ACCCGCAGCGCCTGTTCGGGGCTGCTTGAGGAGCCGAGCCGATGCAACCTTTCGTCTACGAAACAGCCCCAGCGCGCGTCGTTTTCGGGCGCGGCACTTCGCAGAATCTGCGGCGGGAAC TTGAGGCCCTGAATTTTGGCAGGGCGCTGGTTCTTTCCACGCCCGACCAAAAAGAACAATCGCTGCGAATTGCCCAGGGCCTGGGTTCTCAGCTGGCGGGGTCGTTCCACGCCGCTGCCA TGCATACGCCTGTCGAGGTCACCTTGCAGGCGCTTGAGGTGCTGAAGGATGTGCAGGCCGATTGCATCGTGGCGATTGGCGGCGGCTCAACCATTGGGTTGGGCAAGGCACTGGCCCTGC GCACCGATCTGCCGCAGATCGTCGTCCCGACGACTTATGCCGGCTCGGAAATGACGCCGATCCTGGGAGAGACGGAAAACGGGCTGAAGACCACACAGCGTAATCCCAAAGTGCAGCCGA GGGTGGTTCTCTACGATGTGGACCTGACTGTGACGCTTCCGGTGCAGGCCTCGGTTACATCAGGCATGAATGCGATCGCCCATGCGGCCGAGGCATTATATGCGCGGGACGGCAATCCGG TGATCTCGCTGATGGCCGAAGAGGCGATCCGCGCGCTGGCCCATGCCCTGCCGCGTATCGTTGCCACTCCCGACGATATCGAAGCGCGCAGCGATGCCCTCTATGGCGCGTGGCTGTGCG GAACGTGCCTGGGTTCGGCCGGAATGGCGTTGCACCATAAGCTCTGCCACACCCTCGGCGGAAGTTTCGATTTGCCACATGCCCCGACCCACACGGTCATCCTCCCCTATGCGCTCGCCT ATAATAGTGATGCGGCCAGGCCCGCAATGGCAGCCATCGCGCGCGCGCTGGGCATGGCGGATGCAGCGATGGGCATGAGAGCGTTGTCCATGCGGTTGGGCGCCCCGACATCGCTGCGTG AGTTGGGCATGGCAGAAGCCGATCTTGACCGCGCCGCCGACCTGGCCACGCAAAATGCCTATTGGAACCCGCGACCCATCGAGCATGGGCCGATTCGTAACCTTCTGGGACGGGCCTGGG CTGGAACTCCGGTCTGAAGGACCTAGAGGACAGTCAATTCATTGATCTGAAGTCACCAACGAGGAGATATGGGATGAACGAGAACATTGCGATCCGCAAATTGGGCCGCCGACTCCGATT GGGCATTGCCGGTGGCGCGGGTCATTCGCTGATTGGTCCGGTTCACCGGGAGGCGGCTCGGCTTGACGATTTGTTCTCTCTCGATGCTGCGGTGCTGTCCAGTAACGCGGAACGCGGGGA TGCTGAGGCCGCGGCTCTCGGAATTCCGCGCTCCTATTCGTCCACCGCCGAGATGTTCGCAATGGAGAAGGCTAGGCCCGACGGTATTGAGGCCGTTGCCATAGCCACGCCGAATGACAG CCATTACCGGATTCTGTGCGAGGCGCTGGACGCCGGGTTGCATGTAATCTGCGACAAGCCTTTAACCTCCACGAAGGCCGAGGCCGACGACGTGCTGGTGCGGGCGAAGGCCGCGGGCAA GGTTGTGGTCCTGACCCACAATTATTCTGGCTACGCCATGGTACGCCAAGCCCGCGCCATGGTCGCCGCCGGTGAACTTGGGAAAATCCACCAGATTCACGGGGTCTACGCTCTGGGCCA GATGGGCCGTTTGTTCGAGGCCGACGAAGGGGGCGTGCCTCCGGGGATGCGTTGGCGGATTGATCCTGCGCGCGGTGGCGACAGTCACGCCCTGGTGGATATCGGCACCCATGTGCACCA TCTGGCTACCTTCATCACGCAGTTACAGGTCGTTGAGGTAATGGCCGATCTTGGGCCGGCGGTTCAAGGCCGCGCGGCCCATGACAGTGCCAACGTCATGTTCCGTATGGAAAACGGAGC TTTCGGATCGTTCTGGGCCACCAAGGCGGCATCGGGGGCCAGCAAGCTGGCGATCGAAGTCTACGGTGACAAGGGCGGCGTCCTGTGGGAGCAGGCCGACGCCAATAACTTGCTACATAT GCGGCAGGGCCAACCCCCAGCCCTGATTGGTCGACAAGTTGCCGGGCTGCATCCTGCGGCAATCCGCGCGATGCGGGGGCCGGGTTATCATTTCGTGGAAGGCTATCGCGAGGCCTTTGC GAATATGTACGTGGATTTCGCCGAACAGATCTTGGCCATGATGGGCAAGGGGGCCGCAGATCACCTGGCATTGGAAGCGCCGTCGGTCGTGGACGGCCTGCGCTCCATGGCGTTCATCGA AGCCTGTGTGGCGTCGTCGCAGGACCGCCAATGGCGGCAGGTGGAGCAAGTCAGTTGATCTCTCAGCGGCTTCGGCATTTTTCCCGGGCTGGCGGCTCCCCGCAGCTCCCTCCGGTGGAA AGAACGGGTAATCAAAATAATATTCTGATTTTAAAGGATGTTCCAGACAGCTGATTATTCCTGAAATTTAGGGCTCTTTCGGCTGTAGCAATTGACTAAAAGCCGAATTTAAGGGTAA TTAAACAAACGCTGTTCGTATTATTTAAACAGGTGAGTGATGGCGATATTCCTGGAAGGCTGGCCGATGGTTTCATCTGAATACCCGGCCAGAAGCGTTGAGGCGCACCCGGCCTATCTG AC GCCAGACTATGTTTTCACGCGAAAGCGTGCGCCGACTCGACCGCTGCGGTTAATTCCTCAGTCTGCGACGGAGCTGTATGGCCCGGTTTATGGACAAGAGAGCGTCCGTCCGGGGGATAA CGACCTGACCCGTCAGCACGAAGCTGAGCCGGTGGGGGAGCGGATTCTGGTGACGGGGCGCGTGACCGACGAAGACGGGCGGGGTGTCCCTAATACGCTGCTAGAGATCTGGCAGGCCAA TGCCGCCGGTCGCTATATCCACAAGCTTGACCAGCATCTTGCCCCGCTTGATCCAAATTTCTCGGGGGCAGGGCGTACGGTTACGGGGGCTGATGGCTCTTATTCCTTCATCACGATCGT GCCGGGCGCCTATCCGGTCGTGGGGCTGCACAATGTCTGGCGCCCGCGCCACATCCATGTGTCGTTGTTCGGTCCGTCCTTCGTGACCCGCTTGGTTACCCAGATATATTTCGAGGGCGA TCCGCTGCTGAAATATGACACGATCTACAACACGGCGCCCGACATCTCGAAGCGCAGCATGGTGGCGCAGTTGGACATGGGCGCCACGCAATCCGAATGGGGCCTGACCTATCGCTTCGA CATCGTTCTGCGTGGGCGCAACGGCAGCTATTTCGAGGAACCCCATGACCACTAAGACCCCACTGACCATCACCCCCTCGCAGACTGTCGGGCCTTTCTATGCCTATTGCCTGACCCCGG AGGACTACGGGACGCTTCCACCGCTGTTCGGCGCGCAGCTTGCGACCGAGGACGCCGAAGGGGAACGGATTACGATCCAGGGAACGATCACGGACGGAGAGGGGGCCATGGTTCCCGATG CCTTGATCGAGATCTGGCAGCCGGACGGGCAGGGGCGTTTTGCTGGAGCCCATCCAGAGCTGCGGAATTCGGCCTTCAAGGGCTTCGGGCGCCGCCACTGTGACAAAAGCGGAAACTTCA GTTTCCAAACCGTGAAGCCTGGCCGGGTGCCCACTGCCGACGGCGTGATGCAGGCACCCCATATCGCTTTGTCGATCTTCGGCAAGGGATTGAACCGCCGGCTCTATACGCGGATCTACT TCGCAGACGAGGCATCGAATGCCGAGGACCCCGTTCTGTCGATGCTGTCCGAGGATGAGCGCGTGACCCTGATCGCCACCTCTGAATCGCCCGCCGCATATCGCCTCGACATCCGCCTGC AAGGCGACGGCGAAACGGTGTTTTTCGAGGCCTGAGTCGGCCGGCAAGTTTGCGGGGATCCGTCCGCCGCAATTGTGTTTCGCTATAGACGCCACGGCTGCCGCATGCCGCCGGGTGGAA GGGCCTTGCAAGGCCTGTCAACGGCGGAGTAAAATCCGGCCAGGCGGCGGAGTAAAACCAGGCCACTTGTGGCCCACGCATGAGACACCCGGGAGGGCGTAGCCCAAGCGGGGGTCTCAT GCGTGTGCGGCGGTTTTCTGGGGGTTCAGCCAGCCTTGCGGGCGCGGCTTTGAGCGAGACGATAGCTGTCGCCGTTCATCTCGAG

62 62 Fehérjeszekvenciák összehasonlítása

63 63 Ar1Ar2 oriV Ar2 Ar1 Ar2 oriV Gének irányított szétroncsolása interpozon mutagenezis poláris hatás vad típus mutáns oriT oriV: szűk gazdaspecificitás Ar: antibiotikum rezisztencia

64 64 Table 20.1 Génsűrűség különböző élőlényekben

65 65 Dot-blot technika Radioaktív génspecifikus próba Különböző sejtekből preparált teljes RNS-ek szilárd hordozóra kötve Hibridizáció A pozitív RNS minták jelölődnek Reverz dot-blot technika Génspecifikus minták rögzítése szilárd hordozóhoz Teljes RNS jelölése Hibridizáció Pozitív génspecifikus minták jelölődnek DNS-chip technika ,000 Génspecifikus minta Hibridizálás DNA-chip Lab.BRC, Szeged

66 66 Figure Bone marrow cell from patient Retrovirus capsid Viral RNA Cloned gene (normal allele, absent from patient’s cells) 2 Alkalmazások, humán génterápia

67 67 Alkalmazások, transzgenikus állatok Figure 20.18

68 68 APPLICATION Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. TECHNIQUE Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. RESULTS 1 The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. 2 Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. 3 Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts T DNA DNA with the gene of interest Recombinant Ti plasmid Plant with new trait Figure Alkalmazások, transzgenikus növények

69 69 Defendant’s blood (D) Blood from defendant’s clothes Victim’s blood (V) D Jeans shirt V 4  g 8  g Alkalmazások, kriminológia, apaság, anyaságvizsgálat

70 70 Alkalmazások, környezetvédelem Olaj, Klórozott szénhidrogének, Bármilyen ártalmas anyag 16 h 84 h

71 71 Szulfonált aromás vegyületek lebontása Nitrokémia Rt. elfolyó szennyvízben nagy mennyiségű szulfanilsav azofestékek, növényvédőszerek, antibiotikumok alapanyaga Igény biológiai eltávolításra Izoláltunk egy baktériumot, mely képes a szulfanilsavat, mint egyedüli szén-, nitrogén- és kénforrást hasznosítani ezzel a tulajdonságával egyedülálló a világon

72 72


Letölteni ppt "1 A NUKLEINSAVAK MANIPULÁCIÓJA SORÁN HASZNÁLATOS ENZIMEK RESTRIKCIÓS ENDONUKLEÁZOK Három fő csoport 1970 – A molekuláris biológia forradalmának kezdete."

Hasonló előadás


Google Hirdetések