Az előadás letöltése folymat van. Kérjük, várjon

Az előadás letöltése folymat van. Kérjük, várjon

1 „Az oktatás és kutatás színvonalának emelése a Szent István Egyetemen” (TÁMOP-4.2.1.B-11/2/KMR-2011-0003) A fertőző állatbetegségek laboratóriumi diagnosztikája,

Hasonló előadás


Az előadások a következő témára: "1 „Az oktatás és kutatás színvonalának emelése a Szent István Egyetemen” (TÁMOP-4.2.1.B-11/2/KMR-2011-0003) A fertőző állatbetegségek laboratóriumi diagnosztikája,"— Előadás másolata:

1 1 „Az oktatás és kutatás színvonalának emelése a Szent István Egyetemen” (TÁMOP B-11/2/KMR ) A fertőző állatbetegségek laboratóriumi diagnosztikája, a megelőzés lehetőségei. (kiemelt kutatási terület)

2 2 Élelmezésbiztonság = Az élelmiszerek alapjául szolgáló termékek igényeknek megfelelő mennyiségben történő előállítása

3 3

4 4 Csirke- és pulykaállományokban enterális fertőzést okozó vírusok elterjedtségének és kóroktani szerepének további vizsgálata Mándoki Míra, Liptai Orsolya, Rusvai Miklós

5 5 Baromfitartás • csirke (Gallus gallus domesticus) • pulyka (Meleagris gallopavo) broilerállományok: nagyüzemi, iparszerű tartás új, összetett kóroktanú betegségek, melyekben több kórokozó és környezeti tényezők játszanak szerepet • emésztőszervi betegség komplex (enteric disease, ED)

6 6 Enterális kórképek csirkeállományokban • Runting-stunting syndrome (RSS) – 1-4 hetes életkor • hasmenés, gubbasztás, alomevés, csipogás és összebújás – változó morbiditás és mortalitás, másodlagos fertőzések: baktériumok, gombák, vírusok • gazdasági kár: csökkent téteményképesség, fejlődésben való visszamaradás, megnövekedett gyógykezelési költség, csökkent takarmányhasznosítás – Oktan: Astroviridae, Coronaviridae, Reoviridae, Adenoviridae, Parvoviridae etc.

7 7 • Poult enteritis complex (PEC) – hasmenés, gubbasztás, immunszuppresszió, alomevés és megnövekedett mortalitás – nagy gazdasági jelentőség • Oktan – enteropathogén E. coli törzsek – Coronaviridae, Astroviridae, Reoviridae, Parvoviridae etc. • Poult enteritis and mortality syndrome (PEMS) – akár 100% morbiditás és mortalitás Enterális kórképek pulykaállományokban

8 8 Az enterális kórképek oktanában vélhetőleg szerepet játszó vírusok • Astrovirusok – avian nephritis virus (ANV) – turkey astrovirus (TAstV) • Coronavirusok – turkey coronavirus (TCV) – infectious bronchitis virus (IBV) • Adenovirusok – avian adenovirus group I (AAdVI) – hemorrhagic enteritis virus (HEV) • Reovirusok (ARV) • Rotavirusok (AvRV) • Parvovirusok – chicken parvovirus (ChPV) – turkey parvovirus (TuPV)

9 9 Anyag és módszer • 3 év során ( ) beküldött esetek • 1-4 hetes csirke- (87) és pulykaállományok (6) • boncolás és kórszövettan • bakteriológiai vizsgálat • indirekt immunhisztokémia (IHC) • polimeráz láncreakció (PCR)

10 10 PCR and RT-PCR: chicken samples Targeted virusTargeted gene Primer name and sequence (5 ’ -3 ’ ) Size (bp)Annealing ChPV / TuPV NS1 PVF1: TTCTAATAACGATATCACTCAAGTTTC PVR1: TTTGCGCTTGCGGTGAAGTCTGGCTCG ANV GP1 ANV-ORF1-f: AGATACGCTTGCTCGTCTTG ANV-ORF1-r: CCTCTAACCGGCGATATTCT CAstV ORF 1b ANVpol1F:GYT GGG CGC YTC YTT YGA YAC ANVpol1R:CRT TTG CCC KRT ART CTT TRT TAstVs ORF-1b TAPG-L1:TGG TGG TGY TTY CTC AAR A TAPG-R1:GYC KGT CAT CMC CRT ARC A TAstV-2 capsid ORF 2 MKCAP8F:TCA TCA TCC TCT CAC ACT GG MKCAP19R:AGC AGC AGT AGG TGG CAG TG TCV nucleocapsid TCV-NF:GGT AGC GGT GTT CCT GA TCV-NR:CCC TCC TTA CCT TTA GT HEV CP1 HEV-CP1-F: GGTTCGTGAACATTGGAGAC HEV-CP1-R: CAGGCACAACAGGTGTAACT ARV S4 S4-F13:GTG CGT GTT GGA GTT TCC CG S4-R1133:TAC GCC ATC CTA GCT GGA AvRV NSP4 NSP4-F30:GTG CGG AAA GAT GGA GAA C NSP4-R660:GTT GGG GTA CCA GGG ATT AA AAdV1 Hexon H1:TGG ACA TGG GGG CGA CCT A H2:AAG GGA TTG ACG TTG TCC A

11 11 Eredmények Megfigyelés: szétnövés, gubbasztás

12 12 Megfigyelés: szétnövés, gubbasztás Eredmények

13 13 Boncolás: szétnövés, hasmenés Eredmények

14 14 Boncolás: szétnövés, hasmenés Eredmények

15 15 Boncolás: enterits Eredmények

16 16 Boncolás: enterits Eredmények

17 17 Boncolás: enterits Eredmények

18 18 Boncolás: enterits Eredmények

19 19 Kórszövettan: enteritis, a bélbolyhok megrövidülése, fúziója ( jejunum, H&E ) Eredmények

20 20 Kórszövettan: enteritis, granulocyták, histiocyták, lymphocyták ( jejunum, H&E )

21 21 Immunhisztokémia: vírusantigén kimutatása ( jejunum, ChPV )

22 22 Immunhisztokémia: vírusantigén kimutatása ( jejunum, ChPV )

23 23 Eredmények PCR vizsgálatok pulykaállományokban ÉvÉv Esetsz á m 42 ChPV/TuPV21 TuAstV-212 AvAst10 Reo10 AvRota, ANV, HEV, TCoV nem volt kimutatható

24 24 ÉvÉv é v átlaga Esetsz á m ChPV/TuPV9 (69%)29 (81%)33 (87%) 79%  Reo3 (23%)32 (89%)27 (71%) 61%  ANV8 (62%)21 (58%)18 (47%) 56%  ChAstro5 (38%)18 (50%)11 (29%) 39%  AvAst6 (46%)8 (22%)4 (11%) 26%  AvRota1 (8%)2 (6%)0 5%  Eredmények PCR vizsgálatok csirkeállományokban

25 25 PCR vizsgálatok csirkeállományokban é v 0 v í russal 11 1 v í russal v í russal v í russal v í russal v í russal v í russal 11 2,463,082,472,72 Eredmények

26 26 • A felmérés tanúsága szerint a csirkeállományok enteritissel járó kórképe esetén leggyakrabban parvovírusok és reovírusok mutathatók ki • A parvovírusok előfordulási aránya folyamatosan növekszik • Igen gyakori a többszörös fertőzés Megbeszélés

27 27 Köszönöm a figyelmet! Az oktatás és kutatás színvonalának emelése a Szent István Egyetemen" (TÁMOP B-11/2/KMR )


Letölteni ppt "1 „Az oktatás és kutatás színvonalának emelése a Szent István Egyetemen” (TÁMOP-4.2.1.B-11/2/KMR-2011-0003) A fertőző állatbetegségek laboratóriumi diagnosztikája,"

Hasonló előadás


Google Hirdetések